Clinical and molecular identification of ruling Theileria annulata strains in cattle calves in Al-Diwaniyah province, Iraq
A. Jassim1, M.A. Alfatlawi2, N.I. Jarad2 and S.F. Klaif3
1 Department of Internal Medicine, 2 Department of Veterinary Microbiology, 3 Unit of Zoonotic Disease Research, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq
Email: 1 [email protected], 2 [email protected], 3 [email protected], 4 [email protected]
*Corresponding author: M.A. Alfatlawi, [email protected].
ORCID: 1 0000-0002-0871-2155, 2 0000-0002-7874-7783, 3 0000-0003-3647-266X, 4 0000-0003-2743-0732
2019-12-19
2020-03-17
Abstract
This study aimed to investigate the evolutionary status of T. annulata in Al-Diwaniyah province, Iraq. In this study, the clinical examination of 50 infected animals was performed with blood sample collection (2.5ml per animal), and drug targets cytochrome b, a vital component of the electron transfer chain in the mitochondria of the protozoan, cytb gene was targeted using a polymerase chain reaction (PCR) procedure. Also, 18S rRNA gene as a molecular target for the PCR and a partial gene sequencing (PGS) were included. The PCR that involved using the 18S rRNA and cytb genes as genetic targets revealed amplification of the targeted pieces at 620bp and 1092bp, respectively, in all tested samples. The18S rRNA gene sequence of local T. annulata isolates were aligned with global reference strains for T. annulata recorded in the GenBank. The local strains were close, 100%, in their identity to isolates from Iran, Turkey, and Pakistan; however, they were 99% similar to a nucleotide sequences from India and Bangladesh. Diseased calves showed clinical signs such as high fever (40.3-41.5°C), decreased appetite or in appetence, asymmetrical enlargement of superficial lymph nodes particularly the pre-scapular ones, some cases with diarrhea, pale or icteric mucus membrane of eyes, bulging eyes, lacrimation, ecchymotic hemorrhages on the sclera, incoordination, nervous signs (Dullness, depression, lethargy), salivation, and bloated young calves. The data observed from the present inspecting work may reveal genetic evolution in the local strains with others recorded in the GeneBank. This means that our local strains might have close relationships with some global strains.
Keywords: 18S rRNA gene, buparvaquone, cytb gene, drug resistance, Thieleria annulata.
10.33899/ijvs.2020.126429.1319
التعریف السریری والجزیئی لسلالات ثایلریا الحلقیة فی عجول الماشیة فی محافظة الدیوانیة، العراق
اسعد جاسم1، منیر عبد الامیر الفتلاوی2، نور عیدان جراد2 و صبا فلاح خلیف3
1فرع الطب الباطنی والوقائی، 2فرع الاحیاء المجهریه البیطریه، 3 وحدة بحوث الامراض المشترکه، کلیة الطب البیطری، جامعة القادسیة، الدیوانیه، العراق.
الخلاصة
هدفت هذه الدراسة إلى دراسة الحالة التطوریة الثلاریا الحلقیة فی محافظة الدیوانیة، العراق. فی هذه الدراسة، تم إجراء الفحص السریری لخمسون عجلاً مصابًا عن طریق جمع عینة دم (2.5 مل لکل حیوان). أیضا، کما تضمن البحث فحص تفاعل السلسلة المتبلمرة لجینات الرنا الریباسومی 18 کهدف وتسلسل الجینات الجزئی. کشف فحص تفاعل السلسلة المتبلمرة الذی تضمن استخدام جینات الرنا الریباسومی 18 و cytb کأهداف وراثیة تضخیم القطع المستهدفة عند 620 نقطة أساس و 1092 نقطة أساس، على التوالی، فی جمیع العینات التی تم اختبارها. تم الاستقصاء عن تسلسل جین الرنا الریباسومی 18 لعزل T. annulata المحلی مع السلالات المرجعیة العالمیة إلى T. annulata المسجلة فی بنک الجینات. کانت السلالات المحلیة متقاربة بنسبة 100٪ فی هویتها لعزلة من إیران وترکیا وباکستان. ومع ذلک، کانت 99 ٪ مماثلة لسلسلة النیوکلیدات من الهند وبنغلادیش. تظهر العجول المصابة علامات سریریة مثل ارتفاع فی درجة الحرارة 40.3-41.5 درجة مئویة، انخفاض الشهیة أو انعدامها، تضخم غیر متماثل فی الغدد اللیمفاویة السطحیة وخاصة تلک التی تسبق الکتف، بعض الحالات تصاحبها إسهال أو غشاء مخاطی شاحب أو مصفر للعیون، عیون منتفخة، تسمم، بقع نزیف فی العین وخلل فی الحرکة وأعراض عصبیة کالتحسس، والاکتئاب، والخمول، وزیادة إفراز اللعاب، والعجول تعانی من الانتفاخ. کشفت البیانات التی تم رصدها من أعمال الفحص الحالیة عن التطور الوراثی للسلالات المحلیة مقارنتا مع سلالات أخرى مسجلة فی بنک الجینات. هذا یعنی أن سلالاتنا المحلیة قد تکون لها علاقات وثیقة مع بعض السلالات العالمیة.
Introduction
Theileria annulata is an important parasitic species responsible for economic crises leading to high global morbidity and mortality in animals (1,2). The genus Hyalomma is well-known for transmitting these protozoa leading to the induction of bovine tropical theileriosis (BTT) in the Middle East countries including Iraq (3,4). Molecular study of the tick Hyalomma anatolicum in Iraq have been recorded this spp. in Najaf city (5). The severity of clinical signs of tropical theileriosis depends on the type of animal breeds and on the age of animals; however, and the most common signs are anorexia, high bodytemperature, superficial lymph node enlargement (especially the prescapular, submandibular, and pre-femoral lymph nodes), pale of mucus membranes at early stages followed by an icteration at the late stages, uncommon blood-stained diarrhea, dehydration, salivation, lacrimation, nasal discharge, nervous signs, and dyspnea (6,7).
The classical methods for the diagnosis of theileriosis depend on using microscopy involving lymph and blood smears stained by Giemsa stain for checking the presence of Koch’s bodies and the piroplasm (8). Many problems were shown due to the use of the smear methods that reflect low sensitivity for the diagnosis of carrier animals (9). For a quick and accurate diagnosis, molecular methods such as PCR techniques have been employed for the identification of Theileria spp (10-12).
For treatment, buparvaquone, the most effective drug against bovine theileriosis (13,14), at 2.5mg/kg.bw intramuscular (IM) as a single dose (15). However, Tunisian and Sudan veterinarians have reported failures of this drug at the recommended dose (2) probably due to developed resistance in those protozoa against the drug (16). Previous studies showed that hydroxynaphthoquinone works via its binding to one of the electron transport chain components, cytochrome b (cytb gene), resulting in suppressing this vital biological process in the target parasite. Resistance to antiprotozoal drugs can be resulted from certain types of primary or secondary mutations or due to a complete gene deletion (17,18). The present work was aimed to investigate the evolutionary status of T. annulata in Al-Diwaniyah province, Iraq.
Materials and methods
Sample collection
Fifty crossbred calves (age at 15 days to 6 months old) were brought to the Veterinary Teaching Hospital, Al-Diwaniyah City, Al-Diwaniyah Province, Iraq. After clinical examination of the calves, signs of high rectal temperature, enlarged superficial lymph nodes, pale mucous membranes, and tick infestation were recorded. Then, 2.5ml of the jugular vein blood was collected from each calf clinically diagnosed with BTT using high aseptic conditions; EDTA-preloaded blood collecting tubes were utilized. The blood samples were employed in the direct blood smears and molecular analyses.
Microscopic examination
The blood films were Giemsa’s-stained according to a method described by Al-Hosary and Nordengrahen (19). Briefly, the fixed smears were stained with 5% Giemsa diluted in phosphate buffer (pH 7.2). The analysis was performed by microscopic examination.
Genomic DNA extraction
The DNA was extracted as a genomic type from the 50 calf blood sample utilizing a blood DNA extraction Kit (Bioneer, Korea) with relying on the steps included in the kit package. The process was initiated with a Proteinase-K-based lysing step. DNA was Nano Drop (THERMO/USA) evaluated for its amount and purity and stored at -20ᵒC until for next test accomplishment.
Polymerase Chain Reaction
The cytb (1092bp) gene primers for detecting the cytb gene were F: CAGGGCTTTAACCTACAAATTAAC while, R: CCCCTCC ACTAAG CGTCTTT CGACAC ordered through Bioneer (Korea). The 18S rRNA-(620bp) gene targeted designed set of primers (10pmol/each direction) for T. annulata (F: ATTGCTTGTGTCCCTCTGGG and R: TCCACCAACTAAGAACGGCC) were employed for the PCR technique. Applying the instructions of the AccuPower® PCR PreMix kit (Bioneer, Korea), the 20µl-PCR total volume mix was prepared by adding the primers (1.5ul of 10pmole) and 5µl of DNA into the kit tube, that contained components such as 1U DNA polymerase, 250µM of dNTPs, Tris-HCl (pH 9.0) 10mM, 30mM of KCl, 1.5mM of MgCl2, which was completed by adding deionizer PCR water to reach the total volume. The reaction conditions in the thermocycler were the launching step of denaturation programmed at 95°C for 5mins for one cycle. Later, the 30 cycles of the reaction were set up for (the main denaturing process at 95°C for 30s, followed by an annealing step at 58°C for 30s, and the later step of the core extension at 72°C for 1min), and accomplished by applying the final extension process at 72°C for 5mins for one cycle. Electrophoresis was lasted for one hour at 80 volts and 100 am. The visualizing process of the PCR products was performed by placing an electrophoresed 1%-agarose gel treated with ethidium bromide, under a UV transilluminator.
DNA sequencing method
Four purified positive PCR products of the 18S rRNA gene were F-primer-based sequenced by the AB DNA sequencing system (Bioneer Company, Korea) for doing the phylogenetic analysis represented by drawing the phylogenetic tree. The alignment processes and constructing the tree were conducted using the NCBI-Blast alignment and Neighbor Distance (MEGA v6), respectively.
Results
Results of clinical examinations
Diseased calves appear high fever 40.3-41.5°C, decreased appetite or in appetence, asymmetrical enlargement of superficial lymph nodes particularly the pre-scapular ones, some cases with diarrhea, pale and/or icteric mucus membrane of eyes, bulging eyes, lacrimation, ecchymosis hemorrhages on the sclera, incoordination, nervous signs as dullness, depression, lethargy, depression, lethargy in addition to salivation, presence of ticks, and bloated young calves (Table 1).
Table 1: Number and percentage of infected calves with T. annulata according to clinical signs
|
Clinical sings
|
Number with signs
|
%
|
|
Fever, decreased appetite or in appetence, asymmetrical enlargement of superficial lymph nodes, nervous signs and presence of ticks.
|
28/50
|
56
|
|
Fever, diarrhea, presence of ticks and bloated young calves.
|
13/50
|
26
|
|
Fever, bulging eyes, pale or icteric mucus membrane of eyes, lacrimation and presence of ticks.
|
7/50
|
14
|
|
Fever, incoordination, nervous signs, salivation and presence of ticks.
|
2/50
|
4
|
Microscopic examination
The microscopic examination of blood film stained with 5% Giemsa, showed T. annulata in the infected calves (Figure 1).
Figure 1: Microscopical image of blood stained film with giemsa showed T. annulata cytb in the RBC blood samples of calves, oil immersion (X1000).
PCR findings
For the cytb gene, the PCR results unveiled amplification of the genetic piece at 1092bp in all tested samples (Figure 2).
.
Figure 2: Electrophoresed image of 1% agarose gel with the PCR products of T. annulata cytb gene from blood samples of calves. M lane is the ladder (1500-100bp), Lanes (1 to 12) are positive samples at 1092bp.
The PCR that involved using the 18S rRNA gene as a genetic target revealed amplification of the targeted piece at 620bp in all tested blood samples (Figure 3).
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
|
Figure 3: Electrophoresed Image of 1% agarose gel with the PCR products of T. annulata 18S rRNA gene from DNA samples of calves. M lane is the ladder (1500-100bp), Lanes (1 to 16) are positive samples at 620bp.
Sequencing and phylogenetic tree construction of 18S rRNA gene
The 18S rRNA gene of local T. annulata isolates were aligned with global reference strains for T. annulata recorded in the GenBank. The local strains were close, 100%, in their identity to isolates from Iran, Turkey, and Pakistan; however, they were 99% similar to a nucleotide sequences from India and Bangladesh, figure 3. The detected isolates of T. annulata were deposited in the GeneBank with the following accession numbers; MN420930.1, MN420931.1, MN420932.1, and MN420933.1, table 2.
Table 2: Local T. annulata isolates with their NCBI-Genbank accession numbers
|
T. annulata isolates
|
Accession number
|
|
T. annulata IQ.1
|
MN420930.1
|
|
T. annulata IQ.2
|
MN420931.1
|
|
T. annulata IQ.3
|
MN420932.1
|
|
T. annulata IQ.4
|
MN420933.1
|
Figure 3: Phylogenetic tree analysis based on 18S rRNA gene in local T. annulata isolates (green triangles). The UPGMA method in MEGA v6.0 was used to calculate the evolutionary distances.
Discussion
The present investigation study findings showed the presence of the T. annulata in the tested blood samples of the calves. Moreover, four different isolates were detected via the use of the partial gene sequencing analysis. There are increasing incidences when the drug treatment failure is reported when used against T. annulata, in which a study by Mhadhbi et al (16) who unveiled that the occurrence of mutations at the drug-binding site including changing some of the amino acids residues with different ones may introduce incomplete binding of the drug to the CYTB components leading to decrease the activity or complete failure in the activity of the drug in deactivating the electron transfer chain of the parasite mitochondria. In addition to those mutations at the binding site, drug inefficiency was also discovered to be due to the occurrence of mutations at the binding-site-neighboring regions of the CYTB protein which can also enhance the failure of the drug actions in defeating the parasite (16,20).
It has been suggested that increasing the occurrence of the BTT due to T. annulata may increase the percentage of developing mutations in the above mentioned sites or any other structural regions of the protein leading to the failure of the drug in treating the disease, and this supports the idea that our strains, since Iraq is an endemic area with the disease, might have evolved resistance against the drug due to the mass use of the drug in the field. This is supported by a study performed in Sudan by Chatanga et al (21) who showed that multiple-point mutations in the cytb gene may have been responsible of appearing resistance of the parasite against buparvaquone.
The data observed from the present inspecting work may reveal genetic evolution of the local strains with more confidence that our local strains might have been sisters or cousins to global strains that carry parasitic resistance against buparvaquone.
Conclusion
To investigate the evolutionary status of T. annulata in Al-Diwaniyah province, Iraq. We collect 50 blood samples for Molecular identification of T. annulata between cattle calves. The results reveal genetic evolution in the local strains with others recorded in the GeneBank. This means that our local strains have close relationships with some global strains.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady Dean of College of Veterinary Medicine, University of Al- Qadisiyah, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, agency of financing, or elsewhere to conduct this study.
References
- El-Seify MA, Helmy NM, Elhawary NM, Sorour ShS, Soliman AM. Use molecular techniques as an alternative tool for diagnosis and characterization of Theileria equi. Iraqi J of Vet Sci. 2018;32(1):5-11. Doi: 10.33899/ijvs.2018.153787
- Jabbar A, Abbas T, Sandhu ZD, Saddiqi HA, Qamar MF, Gasser RB. Tick-borne diseases of bovines in Pakistan: major scope for future research and improved control. Parasit Vectors. 2015;8(1):283. Doi: 10.1186/s13071-015-0894-2
- Weir W, Karagenç T, Gharbi M, Simuunza M, Aypak S, Aysul N. Population diversity and multiplicity of infection in Theileria annulata. Int J Parasitol. 2011;41(2):193-203. Doi: 10.1016/j.ijpara.2010.08.004
- Alsaad K, Sulieman EG, Al-Obaidi QT. Theileriosis in newborn calves in Mosul, Iraq. Bas J Vet Res. 2013;12(1):265-274. Doi: 10.33762/bvetr.2013.76207
- Al-Fatlawi MA, Ali MJ, Al-Bayati HH. Morphological and phylogenetic study of Hyalomma anatolicum in Al-Najaf, Iraq. Iraqi J of Vet Sci. 2018;32(2):261-6. Doi: 10.33899/ijvs.2019.153860
- Dandasena D, Bhandari V, Sreenivasamurthy GS, Murthy S, Roy S, Bhanot V. A Real-Time PCR based assay for determining parasite to host ratio and parasitaemia in the clinical samples of bovine theileriosis. Sci Rep. 2018;8(1):1-7. Doi: 10.1038/s41598-018-33721-3
- Gharaya G, Rakha NK, Maan S, Kumar A, Kumar T, Jhambh R. Comparative evaluation of polymerase chain reaction assay with microscopy for detection of asymptomatic carrier state of theileriosis in a herd of crossbred cattle. Vet World. 2016;9(9):1039-42. Doi: 10.14202/vetworld.2016.1039-1042
- AL-Fatlawi MA, Ali MJ, Albayati HH. Morphological and phylogenetic study of Hyalomma anatolicum in Al-Najaf, Iraq. Iraqi J of Vet Sci. 2018; 32(2):261-266. Doi: 10.33899/ijvs.2019.153860
- Shinuo CAO, Zhang S, JIA L, Xue S, Yu L, Kamyingkird K, Moumouni PFA, Moussa AAE, Zhou M, Zhang Y. Molecular Detection of Theileria Species in Sheep from Northern China. J of Vet Med Sci. 2013;75(9): 1227-1230. Doi: 10.1292/jvms.13-0028
10.Kundave VR, Patel AK, Patel PV, Hasnani JJ, Joshi CG. Detection of theileriosis in cattle and buffaloes by polymerase chain reaction. J Parasit Dis. 2015; 39(3): 508-513. Doi: 10.1007/s12639-013-0386-2
11. Mani S, Muthusamy RB, Kandasamy K. Clinical, hematological changes and therapeutic efficacy of buparvaquone with oxytetracycline against the natural infection of Theileria annulata in cattle. Int J Livest Res. 2017;1:128-133. Doi: 10.5455/ijlr.20170716010544
12. Al-Fatlawi MH, Al-Fatlawi MA. Molecular and phylogenetic study of Theileria Spp. isolated from ticks in Al-Diwaniyah city, Iraq. Iraqi J of Agricul Sci. 2019;50(1):475-9. Doi: 10.36103/ijas.v50i1.313
13. Ayadi O, Gharbi M, Benchikh MC. Haematological and biochemical indicators of tropical theileriosis diseased cattle in wilaya of Sétif (North East Algeria). J Parasit Dis. 2017;41(2):538-42. Doi: 10.1007/s12639-016-0846-6
14. Verma A, Verma SK, Verma SK, Verma RK, Singh NK. Therapeutic management of theileriosis in cross bred calves. J Pharma Phytochem. 2018;7(3):3162-3. Doi: 10.1007/s12639-014-0457-z
15. Silatsa BA, Simo G, Githaka F, Kamga R, Oumarou F, Tiambo CK, Machuka E, Domelevo J, Odongo D, Bishop R, Kuiate J, Njiokou F, Djikeng A, Pelle R. First detection of Theileria parva in cattle from Cameroon in the absence of the main tick vector Rhipicephalus appendiculatus. Transboundary and Emerging Dis. 2020; 67(1): 68-78. Doi: 10.1111/tbed.13425
16. Mhadhbi M, Chaouch M, Ajroud K, Darghouth MA, Ben S. Sequence polymorphism of cytochrome b gene in Theileria annulata Tunisian isolates and its association with buparvaquone treatment failure. PLoS One. 2015;10(6):1-11. Doi: 10.1371/journal.pone.0129678
17. Munday JC, Tagoe DNA, Eze AA, Krezdorn JM, Rojas López KE, Alkhaldi AM. Functional analysis of drug resistance-associated mutations in the Trypanosoma brucei adenosine transporter 1 (TbAT1) and the proposal of a structural model for the protein. Mol Microbiol. 2015;96(4):887-900. Doi: 10.1111/mmi.12979
18. Hyde JE. Mechanisms of resistance of Plasmodium falciparum to antimalarial drugs. Microbes Infect. 2002;;4(2):165-74. Doi: 10.1016/S1286-4579(01)01524-6
19. Al-Hosary AT, Nordengrahen N. New approach to use blood smears for diagnosis of bovine theileriosis. Indian J Anim Res. 2018;10(1):1-4. Doi : 10.18805/ijar.B-870
20. Sharifiyazdi H, Namazi F, Oryan A, Shahriari R, Razavi M. Point mutations in the Theileria annulata cytochrome b gene is associated with buparvaquone treatment failure. Vet Parasitol. 2012;187(3-4):431-5. Doi: 10.1016/j.vetpar.2012.01.016
21. Chatanga E, Mosssad E, Abdo AH, Amin AS, Katakura K, Nakao R. Evidence of multiple point mutations in Theileria annulata cytochrome b gene incriminated in buparvaquone treatment failure. Acta Trop. 2019;191:128-32. Doi: 10.1016/j.actatropica.2018.12.041