Genotypic analysis of ticks species infesting cattle in Al-Diwaniyah abattoir
Mansour Jadaan Ali1, Wisam Raheem Atiyah2, M.A. Al-Fatlawi1, and S.F. Klaif3
1Department of Veterinary Microbiology, 2Department of food hiegen, 3Unit of Zoonotic Disease Research, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq
[email protected], 0000-0002-0093-8299
[email protected], 0000-0003-4441-1242
[email protected], 0000-0002-7874-7783, Corresponding author
[email protected], 0000-0003-2743-0732
2020-07-24
2020-09-16
Abstract
Different vectors are considered critical for disease transmission between animals; however, ticks play a significant role in the dissemination of various infectious illnesses of animals and human importance. The current work was carried out to categorize ticks genetically of those isolated from cattle that entered Al-Diwaniyah abattoir. In the present study, 50 tick samples were collected and subjected to microscopic examination and genetic-based methods of polymerase chain reaction and partial gene sequencing, both utilized the mitochondrial cytochrome c oxidase subunit I (COX1) gene as a genotyping element. The findings of the microscopic examination showed that the ticks were from Hyalomma spp. Further analysis, the polymerase chain reaction revealed the genus of Hyalomma of the ticks, but when the PGS was performed, one sample of H. detritum, three samples of H. excavatum, and two samples of H. marginatum were identified. When the phylogenetic analyses were conducted, H. detritum showed close genetic similarity to an isolate from Spain EU827695.1. H. excavatum revealed similarity with isolates from India MK863382.1 and Turkey MT230050.1. In contrast, H. marginatum displayed close identity to an isolate from Iran (MG557555.1). In conclusion, these findings may indicate evolutionary links of the locally identified isolates to different world isolates, probably due to the trade-moving of animals.
Keywords: H. detritum, H. excavatum, H. marginatum, Ticks, Al-Diwaniyah
التحلیل الجینی لأنواع القراد المتطفلة عل الماشیة المذبوحة فی مجزرة الدیوانیة
منصور جدعان علی1، وسام رحیم عطیه2، منیر عبد الأمیر عبد الفتلاوی1 و صبا فلاح کلیف3
1 فرع الأحیاء المجهریة البیطریة، 2 فرع الصحة العامة، 3 وحدة بحوث الأمراض المشترکة، کلیة الطب البیطری، جامعة القادسیة، الدیوانیة، العراق
الخلاصة
یلعب القراد دورا مهما فی نشر مختلف الأمراض المعدیة ذات الأهمیة الحیوانیة والإنسانیة. أجریت الدراسة الحالیة لتصنیف القراد وراثیا فی العینات المعزولة من الماشیة التی کانت معدة للذباحة فی مجزر الدیوانیة. تم جمع 50 عینة من القراد التی خضعت للفحص المجهری وفحوصات تفاعل سلسلة البلمرة ودراسة التتابع الجینی الجزئی، تم فی الفحصین الأخیرین استخدام جین بیوت الطاقة المعروف بـ (COX1) لغرض التنمیط الجینی. أظهرت النتائج التی توصلت إلیها الفحوصات المجهریة إلى أن القراد کان من جنس قراد زجاجی العین. کشف فحص تفاعل السلسلة المتبلمرة أیضا انتماء عینات القراد إلى جنس زجاجی العین، ولکن عندما تم إجراء فحص تتابع الجین الجزئی، اتضح أن احدى العینات کانت تنتمی إلى نوع H. detritum، وثلاث عینات إلى نوع H. excavatum، وعینتین تعود إلى نوع H. marginatum. عندما أجریت تحلیلات تطور الجینات، أظهر الفحص أن عزلة H. detritum تتشابه وراثیا مع عزلة من إسبانیا. کشف التحلیل أیضا أن نوع H. excavatum تتشابه مع عزلات من الهند وترکیا. بینما أظهرت H. marginatum هویة قریبة لعزلات من إیران. یستنتج من هذه النتائج إلى احتمالیة وجود روابط تطوریة للعزلات المحلیة للدراسة الحالیة مع العزلات العالمیة المختلفة ربما بسبب النقل التجاری للحیوانات بین العراق وتلک الدول أنفة الذکر.
Introduction
Ticks are the most diversified arthropod vectors for human and livestock animals. Among such, ticks contain the most numerous collection of infectious agents. Human tick-borne pathogens, similar to the tick-borne associated diseases of farm animal species, are zoonotic diseases of livestock origin, in the epidemiology and ecology of tick-borne disease, complex interactions between the biotic and abiotic. Studies have established the theory that zoonotic organisms and their vectors are present in various environments, and landscape epidemiology has resulted in communicable diseases. Alterations in ticks density, in prevalence, as well as in animal interactions, transport, land use, and habitat modifications, can affect tick and tick-borne pathogenic demographic profiles (1-6).
There have been, are, and will continue to be modifications to the demographic makeup of tick communities. Changes of some of the known factors affecting tick populations will change the extent and abundance of these essential disease vectors. Synchronized changes are taking place among the complicated structures of micro- and macro-level factors requiring increased surveillance of these tick populations. In addition to many variables that may work together to create the observed changes, the geographical range and abundance of ticks are increasingly changing. A complex ecosystem of biotic and abiotic variables, including changes in animal and human demographics and behavior, influences both tick population densities and distributions. Aside from their immediate impact on ticks, a large number of tick-related micro-organisms and tick diseases, along with additional danger to public health of tick-like paralysis and other toxicity is affected by biotic and abiotic elements (7-10). The dynamic, evolving complexity of the tick vectors and tick-borne diseases and dissemination needs persistent surveillance, including studying tick vectors, pathogens, and epidemiological characteristics. The collaboration of multidisciplinary teams involved in tick detection, identification, intervention approaches, awareness, study and testing, scientific and organizational preparation as well as public engagement promote community health responses to vector-borne diseases. As ticks and transmitted diseases do not acknowledge foreign borders, every tick and tick-borne infection network should become part of any comprehensive foreign disease tracking program offering accurate, evidence-based coordination for health agencies, healthcare professionals, other decision-makers, and stakeholders as well as the public (11,12).
According to the information mentioned above, the current work was carried out to categorize ticks genetically of those isolated from cattle that entered Al-Diwaniyahabattoir. The study might place a start point for epidemiological surveillance of ticks and tick-borne diseases in Al-DiwaniyahCity, the southern provinces, and, eventually, the whole country.
Materials and methods
Samples and animals
The study was performed between February and May, 2019. The current work involved taking 50 tick samples from cattle that were prepared to slaughtering. The ticks were collected using ether-soaked pieces of cotton with forceps. Then, ticks obtained from each animal were placed in a separate 70%-ethanol-included container labeled with the animal sex, the collection date, and the part of the body from where the ticks were detached (13). After that, the ticks were transported to the Laboratory of Parasitology, Department of Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah City, Iraq.
Microscopic examination
The ticks were intensively examined under the evaluation of Prof. Dr. Monyer Abdulameir Abd Alfatlawi (specialist in veterinary parasitology), Head of Department of Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al-DiwaniyahCity, Iraq. The ticks were visualized under a dissecting microscope and relying on standard information regarding methods and tick morphological features described by Soulsby (14) and Shubber et al. (15).
Genetic approaches
Polymerase chain reaction
Mitochondrial DNA was extracted using the gSYAN DNA Extraction Kit (Geneaid, USA) and following the kit protocol. For the initiation of the process, 200 mg of each tick was used. A NanoDrop was utilized to evaluate the resulted DNA. The PCR was conducted using the primer set; F: AGGGTCCCCAGATATAGCATT and R: ACCGCCTGAAGGGTCAAAAA. The primer targeted a piece at 415 bp of the COX1 gene (16). The AccuPower PCR PreMix Kit and relying on its instructions were employed for preparing the PCR reaction solution, which included using 5μl DNA, F and R primers 1.5μl 10 pmol/each, and 12 μl PCR water. Then, the mixture was placed in the kit tubes that had a ready-mixture of essential components such as DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, and MgCl2. Later, the mixture was briefly vortexed and entered the thermocycler (MJ-Mini BioRad, USA) at 94ºC, 1min, 1cycle of initial denaturation, 30 cycles of denaturation, annealing, and extension at 94ºC, 0.5 min, 58ºC, 0.5 min, and 72ºC, 1 min, respectively, and the final extension at 72ºC, 5min (16). After that, each well of a 1.5%-agarose gel pre-mixed with 3µl ethidium bromide was inserted with 10 µl PCR product except one well that received 5µl 100 bp ladder. The gel was run on 100 volts and 80 Amp for 1hr. Later, the gel and the bands were overviewed under a UV-light based visualizer.
Partial gene sequencing
The PGS was performed by the AB DNA sequencing system (Bioneer, Korea) using the purified PCR products of six samples and utilizing the same above primers. The sequencing data were deposited in the GeneBank database with an accession number for each isolate. These sequences were analyzed by recruiting the use of NCBI-based nucleotide websites and the MEGA 6.0 software for building the phylogenetic tree and identify comparable global isolates. The evolutionary distances were evaluated by the Maximum Composite Likelihood method.
Results
Microscopic examination
The findings of the ME showed that the ticks were from Hyalomma spp. The ME revealed characteristic morphological features of the mouth parts and genital pore (Figure 1A), Coxa (I, II, and III) (Figure1B), and festoons (Figure 1C and D).
Figure 1: Microscopical examination of tick genus Hyalomma. A. Ventral surface: Mouth parts and genital pore. B. Ventral surface: I, II, and III Coxa. C&D. Ventral surface: Festoons. Olympus (2.5X).
Polymerase chain reaction
Further analysis, the PCR revealed the genus of Hyalomma of the ticks. The amplification bands were at 415 bp (Figure 2).
Figure 2: PCR analysis: Agarose gel electrophoresis 1% shows the DNA fragments of the COX1 gene PCR products and the. Lane 1-8, 415bp Positive samples of genus Hyalomma, and M; a 10000 bp DNA ladder.
Partial gene sequencing and phylogenetic analyses
The PGS uncovered that one sample of H. detritum, three samples of H. excavatum, and two samples of H. marginatum were identified. When the phylogenetic analyses were conducted, H. detritum showed close genetic similarity to an isolate from Spain EU827695.1 (Figure 3A). H. excavatum revealed similarity with isolates from India MK863382.1 and Turkey MT230050.1 (Figure 3B). At the same time, H. marginatum displayed close identity to an isolate from Iran MG557555.1 (Figure 3C).
Figure 3: Phylogenetic tree based on the partial gene sequencing of COX1 gene from Hyalomma ticks. A. H. detritum: Genetically similar to an isolate from Spain EU827695.1. B. H. excavatum: Similarity to isolates from India MK863382.1 and Turkey MT230050.1. C. H. marginatum: Similar to an isolate from Iran MG557555.1.
Discussion
Still, ticks and tick-borne-diseases represent a profound concern with a large global scale. These parasites exist with a broadly dense community of genera and species of human and animal involvement due to the direct effects of sucking blood from their victims and the infectious agents they transmit. For animals, infectious diseases from a long list can cause devastating effects on the health of wild and domestic animals such as protozoal illnesses; for example, babesiosis and theileriosis. On human health basis, many tick-borne diseases that represent a significant worrisome due to the consumption of beef and lamb, such as Crimean Congo hemorrhagic fever (CCHF) that showed up in Iraq on several occasions, the last one in 2018, (17,18).
Many ixodid ticks are used as both the CCHF vector and reservoir. Nevertheless, for the ecology of this virus, ticks of the Hyalomma genus are especially important. CCHF outbreaks are strongly related to the world-famous Hyalomma spp. The Hyalomma genus is a small, robust species of ticks that are well suited to survive in arid biotopes. In Morphology (well-formed rounded head, strong legs), physiology (successful low moisture metamorphosis), actions (active host search), a significant degree of tolerance to hot, and stable in open habitations is evident. The primary host of most species are different animal types, and consequently, these ticks are generally broadened. The majority of this genus species have three hosts, but there are also species of one-host and two-hosts. Early phases feed primarily on mammals and birds, but some species non-adult ticks infect Reptiles of individual species. Together, 27 Hyalomma species invade domestic and wildlife animals, but a few species such as (H. anatolicum, H. marginatum, H. nitidum) species are recognized as CCHF transmitters (19). The current results recorded the presence of H. marginatum, and according to the literature mentioned above, this species may assure the presence of the CCHF and probably its occurrence. Some of the Hyalomma species are considered rare, and if occurred, they go blood-feeding on cows/camels or cows, such as H. detritum and H. schulzei, respectively. Most Hyalomma species are active with high density during hot seasons rather than cold ones (20).
Several animal hosts, including pigs, camels, equines, horses, goats, and dogs, are accessible by H. excavatum, and it may target humans also. Based on the selection of hosts, it is served as a tick of two or three-host. The larvae and nymphs nourish on small vertebrates, birds, and humans with a low rate of presence in winters. This tick occurs in Egypt, Sudan, Eritrea, Iraq, Jordan, Italy, and Greece. CCHF is one of the major diseases that can be transmitted by H. excavatum. It can also transmit babesiosis, theileriosis, and rickettsiasis (21). The findings revealed evolutionary links of the locally identified isolates to different world isolates, probably due to the trade-moving of food animals (22,23).
Conclusion
The tick species recognized in the current study are among those that can transmit dangerous diseases to animals and humans, such as babesiosis and Crimean Congo hemorrhagic. The species identified represent significant similarity with global strains and may indicate evolutionary links of the locally identified isolates to the global isolates, probably due to the trade-moving of food animals.
Acknowledgment
The authors would like to thank the worker in Parasitology laboratory at the College of Veterinary Medicine, University of Al-Qadisiyah.
Conflict of interests
The authors have not received any funding or benefits from industry, agency of financing, or elsewhere to conduct this study.