Morphological and phylogenetic characterization of Oestrus ovis larvae in sheep: Al-Qadisiyah province, Iraq
Nadia S. Alhayali1, Mohenned A. Hemza Alsaadawi2, M.A. Alfatlawi3, and Ali M. J.4
1 Department of Microbiology, College of Veterinary Medicine, Mosul University, Mosul, 2 Department of Parasitology, College of Veterinary Medicine, Al-Muthanna University, Al-Muthanna, 3 Department of Veterinary Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq
[email protected], [email protected], [email protected], [email protected]
0000-0003-4578-2256, 0000-0003-1087-015X,0000-0002-7874-7783,0000-0003-2743-0732
Abstract
The fly larvae infect the nasal cavities and sinuses (frontal and maxillary) of sheep, goats, and a range of wild ruminants, forming a disease called oestrosis (Nasal myiasis or nasal bot). The disease is one of the significantly diseases for the Iraqi small ruminant industry that causes detrimental economic losses. The current work was carried out to morphologically- and molecularly-characterize O. ovis larvae collected from sheep in a slaughterhouse in Al-Qadisiyah province, Iraq. The study depended on collecting 20 larvae (at different stages) from 20 sheep from 15 October till 17 December 2020. The morphological examination was done using a stereomicroscope and relying on larval characteristic features, including the posterior end, spiracles, and cephalopharyngeal skeleton. The molecular characterization was performed utilizing polymerase chain reaction (PCR) and partial gene sequencing (PGS) methods of the cytochrome c oxidase subunit I (cox1) gene at 700-bp and 300-bp regions. Morphologically, the first-stage larvae (L1) showed characteristic mouth hooks, while the second-stage larvae (L2) revealed clear terminal stigmas. For the third-stage larvae (L3), the color of body segments and their spines' were the most important features for this larval stage. The PCR showed amplification at both regions 700bp and 300bp, in 8 and 7 isolates, respectively. The PGS revealed 15 different local isolates in genetic level aligned with isolates from Kyrgyzstan, Italy, Spain, and Turkey. This study shows the important strain differences of O. ovis that infect the local sheep in Al-Qadisiyah province, Iraq.
Keywords: Bot fly, oestrosis, Oestrus ovis, nasal bots
الصفات الشکلیة و الجینیة لیرقة نغف الانف فی الاغنام فی محافظة القادسیة العراق
نادیة سلطان الحیالی1، مهند عبد الحمزة حسین السعداوی2، منیر عبد الامیر عبد الفتلاوی3، منصور جدعان علی3
1 فرع الاحیاء المجهریة، کلیة الطب البیطری، جامعة الموصل، الموصل،2 فرع الطفیلیات، کلیة الطب البیطری، جامعة المثنى، المثنى، 3 فرع الاحیاء المجهریة البیطریة، کلیة الطب البیطری، جامعة القادسیة، الدیوانیة، العراق.
الخلاصة
تصیب یرقات الذباب التجاویف الأنفیة والجیوب الأنفیة (الأمامیة والفکیة) للأغنام والماعز ومجموعة من الحیوانات المجترة البریة، وتسبب مرضًا یسمى نغف الانف ولهذا المرض أهمیة کبیرة بالنسبة لتربیة المجترات الصغیرة فی العراق الذی یتسبب فی خسائر اقتصادیة کبیرة. تم تنفیذ العمل الحالی لتوصیف یرقات طفیلی O. ovisمظهریاً وجزیئیا والتی تم جمعها من الأغنام فی مسلخ فی محافظة القادسیة، العراق. اعتمدت الدراسة على جمع 20 یرقة (فی مراحل یرقیة مختلفة) من 20 خروفا للفترة من 15 تشرین الأول ولغایة 17 کانون الأول لعام 2020. تم إجراء الفحص المظهری باستخدام المجهر وبالاعتماد على خصائص الیرقات الممیزة، بما فی ذلک النهایة الخلفیة، الفتحات التنفسیة، والهیکل العنقی البلعومی. تم إجراء التوصیف الجزیئی باستخدام طرق تفاعل البلمرة المتسلسل ودراسة تعاقب القواعد النتروجینیة للجین cox1 والتی استهدفت مضاعفة نسخ الجین فی قطع طولها 700 زوج قواعد و 300 زوج قواعد . من الناحیة المظهریة، أظهرت یرقات المرحلة الأولى خطافات فمویة ممیزة بینما أظهرت یرقات المرحلة الثانیة وصمات نهائیة واضحة. بالنسبة لیرقات المرحلة الثالثة کان لون أجزاء الجسم ووجود أشواکها من أهم سمات هذه المرحلة الیرقیة. أظهر تفاعل السلسة المتبلمرة تضخیماً فی کلا المنطقتین bp700 و 300 زوج قواعد فی 8 و 7 عزلات على التوالی. کشفت دراسة الـتسلسل الجینی الجزیئی عن 15 عزلة محلیة مختلفة کانت متوافقة وراثیاً مع عزلات من قیرغیزستان وإیطالیا وإسبانیا وترکیا. توضح هذه الدراسة الفروق المهمة لسلالات الـ O. ovisالتی تؤثر على الأغنام المحلیة فی محافظة القادسیة، العراق.
Introduction
Oestrus ovis parasites are well-studied larvae significantly spread around the world. The larvae can affect the nasal cavities and sinuses (frontal and maxillary) of sheep, goats and a known-range of wild ruminants, leading oestrosis, a disease caused by these larvae (1,2). The oviparous insect females move in huge groups around the animal head and place their several-dozen eggs in spots close to the nostrils and into the eyes' orbits (2,3). The ova hatch and the larvae migrate throughout the nasal cavity and sinuses, feeding on mucus and debris, in 2-10 months, the larvae complete their growing phase, migrate back to the nasal cavity, and are sneezed out (4,5). The infected sheep may have nasal discharge (seromucous or purulent), continuing sneezing, and dyspnea (6). Zoonosis is considered a health issue caused by O. ovis, which induces a clinical picture in humans who live close to infected ruminants in rural regions, leading to ophthalmomyiasis, respiratory and non-respiratory involvement (7-10). Oestrosis is found in various areas, and natures of the world are reported from regions, including Asian countries and European and African countries that sit on the Mediterranean coastlines (11). The parasitic infestation was also detected in animals from sub-tropical humid areas to California and some regions that are close to Central America. Some climate factors, such as temperatures 25-28°C, sun radiation 116-838 Wm−2, rainfall 900 mm, and relative humidity 65-85%, can help in encouraging infections by these worms (11). The disease is worldwide and specifically reported in Saudi Arabia, Egypt, Algeria, Benin, and Brazil (12-16).
The disease is of significant importance for the Iraqi small ruminant industry that causes detrimental economic losses. The current work was carried out to morphologically- and molecularly-characterize O. ovis larvae collected from sheep in a slaughterhouse in Al-Qadisiyah province, Iraq.
Materials and methods
Samples and Microscopic Examination
The study depended on collecting 20 larvae (at different stages) from 20 local sheep. The samples were different stages of larvae from the nasal cavities of sheep after slaughtering. They were collected by using forceps gently and putting in tubes, washed using physiological saline, and moved directly to the parasitology laboratory in the College of Veterinary Medicine, University of Al-Qadisiyah, for morphological diagnosis. The morphological examination was done using a stereomicroscope and relying on larval characteristic features, including the posterior end, spiracles, and cephalopharyngeal skeleton. The examination was performed using criteria from Al-Amura et al. (17).
DNA Extraction
Initially, approximately 20mg of the larval tissue was placed in individual Eppendorf tubes to be lysed and extracted using DNA extraction kit (ADDBIO, Korea). Per the instructions of the kit, 200µl/tube of lysis solution and 20µl/tube of proteinase k (20 mg/ml) added. Pestle-based homogenization was used to disrupt the tissues in the tubes, which then incubated at 56c for 3hrs for complete lysis. Then, the tubes were centrifuged at 5000rpm for 2mins. The rest steps of the kit were then done. The concentration and purity of the extracted DNA were measured using a NanoDrop.
Polymerase chain reaction
The molecular characterization was performed utilizing a Semi-nested PCR method of cox1 gene at 700-bp and 300-bp regions. The protocol was adopted from Ipek and Altan (18) as a semi-nested PCR using, for the 700-bp-region, UEA7 (5' TACAGTTGGAATAGACGTTGATAC 3') as a forward oligo (0.5pmol/20µl) and UEA10 (5' TCCAATGCACTAATCTGCCATATTA 3') as a reverse oligo (0.5pmol/20ul). The master mix (ADDBIO, Korea) and the DNA sample were placed together. The thermocycler conditions were 95˚C-5min initial denaturation, 34-cycles of (95˚C-40s-denaturation, 57.7˚C-30s-annealing, and 72˚C-40s-extension), and 72˚C-5min-final extension. For the second-round amplification, an internal forward primer (UEA9) (5' GTAAACCTAACATTTTTTCCTCAACA 3') was employed utilizing the same exact conditions of round-1; however, the annealing step was 60˚C applied on 1µl DNA sample from round-1 amplicons.
Partial cox1 Gene Sequencing
PGS method of the cox1 gene at 700-bp and 300-bp regions was performed using the PCR products purified from the agarose gel.
Results
Morphological outcomes
Morphologically, the first-stage larvae (L1) showed characteristic mouth hooks (Figure 1). While the second-stage larvae (L2) revealed clear terminal stigmas (Figure 2). For the third-stage larvae (L3), the color of body segments and their spines' were the most important features for this larval stage (Figure 3).
Figure 1: Ventral view of the first stage larvae (L1) of Oestrus ovis, note the mouth hooks, 40x.
Figure 2: Dorsal view of second stage larvae (L2) of Oestrus ovis, note the terminal stigmas indicated by the arrows, 40x.
Figure 3. Dorsal view of the third-stage larvae (L3) of Oestrus ovis, note the color of the body segments and spines covering it.
Molecular outcomes: PCR
The PCR showed amplification at both regions 700bp and 300bp, in 8 and 7 isolates, respectively (Figure 4).
Figure 4: Gel electrophoresis image (1 % agarose) of Oestrus ovis targeting cox1 gene. It shows; A. Amplicons at (about 700 bp) generated from the PCR-round-1. One to 8 are positive samples while C is the negative control. B. Amplicons at (about 300 bp) from the PCR-round-2. One to 7 are the positive samples. M is a molecular marker (Intron, Korea).
PGS
The PGS revealed 15 different local isolates that were genetically aligned with isolates from Kyrgyzstan, Italy, Spain, and Turkey (figure 5).
Figure 5: cox1-based phylogenetic tree of Oestrus ovis (red-circled current local and yellow-circled global-NCBI isolates). All these strains are genetically aligned with isolates from Kyrgyzstan, Italy, Spain, and Turkey.
Discussion
Oestrosis in sheep, is caused by the nasal bot larvae (Oestrus ovis), which is obligatory myiasis of sheep and goat nasal cavities. The larva is of a major-world prevalence (16); in many geographical regions, oestrosis highly prevalent, factors that contribute to the prevalence estimate of this larvae need to be emphasized in any survey to estimate the true prevalence of this infection, and to improve the health, welfare status and to reduce the burden of oestrosis in sheep and goat, this need for immunization or implementation of other preventive measures (16). Sneezing and nasal discharge are the major clinical signs in infected sheep with trauma due to mechanical action of spine and hooks during larval movement on mucosal membranes, allergenic reaction provoke byy larval secretion which recognized by sheep immune system, humoral response usually reaches seroconversion 2-4 weeks post first infection (19). Mohammed et al, (4) found that the nasal waste, nasal entries, muco - purulent myasis of frontal sinuses, thinning visit sniffing and dyspnea are the clinical side effects of the movement of hatching in the nasal sinus gaps, during they study the prevalence of O. ovis in sheep in Misan city, Iraq. However, less is understood about the current prevalence and larval evolution in Iraq including Al-Qadisiyah Province.
The identification of the larvae can be made using the morphological characteristics expressed by these worms. Here, the current study was able to recognize them using these features. The study matches this capability with the results of other studies. The results are close to those from Saudi Arabia that identified the larvae in sheep in the Jazan region (20). The author revealed the larvae's identity and species using the morphological and PCR techniques, respectively, targeting a 606bp-region that belongs to the cytochrome oxidase subunit I gene (20). Bosly (20) also performed a partial gene sequencing to the same region of the gene and found 97%-close similarity with an NCBI-GeneBank isolate. The risk of O. ovis larvae according to the abundance in Jazan region and the impact of climate on the infestation, and the importance of controlling the sheep infestation which should be in the beginning of the winter season and for complete prevention, a seasonal treatment in April, is suggested, and every effort should be made to control them by sanitary measures and tools for the pest management (13). İpek and Altan (18) morphologically-noticed the larvae's presence in 38.5% of goats and 84.2% of sheep in Turkey. They also used semi-nested PCR for ~700bp and ∼300bp regions of the cox1 gene. İpek and Altan (18) found that the sequences from their sample larvae were 99% close in similarity to Italian NCBI isolates of the O. ovis, generally they refer to the 2 - step PCR assay described here achieved 100% diagnostic sensitivity and specificity for oestrosis, and the semi-nested PCR and rhinoscopic examination for oestrosis are novel and promising approaches for ante-mortem diagnosis and for future field studies of this parasite.
In results of İpek and Altan (18), the two-round PCR technique revealed a full sensitivity and specificity for the larval diagnosis. They reported higher diagnostic degrees than those recorded by other studies that used the same PCR method. The current study also has the same full-diagnostic power reported by İpek and Altan (18). The similarity of the current isolates from the present work with the isolates from Kyrgyzstan, Italy, Spain, and Turkey can be explained to some degree due to the moving animals and the flies between countries. It’s necessary to know when the parasitic period occure in order to prevent the clinical signs and economic losses caused by O. ovis infection, this knowledge will be a valuable tool to help in choosing the right treatment at the right period (21-25).
Conclusion
The two-round-step PCR (semi-nested) can be used with high confidence in the diagnosis of the Oestrus ovis. The larvae in the tested Iraqi sheep may have a nucleotide-based relationship with isolates from Kyrgyzstan, Italy, Spain, and Turkey due to different reasons, possibly moving animals and flies between countries.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady, Dean of College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, agency of financing, or elsewhere to conduct this study.