Isolation and molecular detection of enterotoxigenic Staphylococcus aureus from raw milk of cows
Dunya Dhafer Taher, Safana A. Yassin and Mariam Hamdi Abdulkareem
Department of Microbiology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq
[email protected], https://orcid.org/0000-0001-5365-0291
[email protected], https://orcid.org/0000-0002-4571-7369
[email protected], https://orcid.org/0000-0001-5056-8452
Abstract
Staphylococcus aureus is a microbe associated with human’s food poisoning. It is caused by isolates producing different heat stable enterotoxins which act as one of the most spread worldwide gastroenteritis causes. The goal of the current study was to assess the incidence of S. aureus (enterotoxigenic) in the raw milk samples of cows which were collected from various places of Baghdad city. Isolation and identification of S. aureus were done by conventional laboratory method and the diagnoses were confirmed by using molecular method RT-PCR to detect the specific gene of S. aureus nuc gene. In addition, we investigate the occurrence of some of Staphylococcal enterotoxins genes such as SEA, SEB, SEC, SED, and SEE. We found that 12/50 (24%) of the isolates were S. aureus and these isolates carried one or more of the enterotoxin genes such as enterotoxin type SEC 12/12 (100) followed by enterotoxin type SEA 7/12 (58.33%) and only 1/12 (8.33%) was type SED, while type SEB and SEE were negative 0%. Some of the isolates have genes that coded for two enterotoxins patterns such as SEA and SEC 7/12 (58.33%) and SEC and SED 1/12 (8.33%). Fewer of the isolates expressed only one genotype of enterotoxin gene like SEC 4/12 (33.3%). This study has proven that there was a high chance of occurrence for the enterotoxigenic S. aureus at the raw milk of cows in Baghdad city.
Keywords: Enterotoxins genes, Nuc gene, Raw milk, RT-PCR, S. aureus
العزل والتشخیص الجزیئی للمکورات العنقودیة الذهبیة المنتجة للذیفان المعوی من حلیب البقر الخام
دنیا ظافر طاهر، سفانة عبد الستار یاسین و مریم حمدی عبدالکریم
فرع الأحیاء المجهریة، کلیة الطب البیطری، جامعة بغداد، بغداد، العراق
الخلاصة
المکورة العنقودیة الذهبیة هی میکروب مرتبط بالتسمم الغذائی للإنسان بسبب إنتاجها الذیفانات المعویة المختلفة الثابتة للحرارة والتی تعمل کواحدة من أکثر أسباب التهاب المعدة والأمعاء انتشارًا فی جمیع أنحاء العالم. إن الهدف من الدراسة الحالیة هو تقییم نسبة حدوث المکورات العنقودیة الذهبیة المنتجة للذیفان المعوی فی الحلیب الخام للأبقار الذی تم جمعه من أماکن مختلفة فی مدینة بغداد. تم عزل وتحدید بکتیریا المکورات العنقودیة الذهبیة بالطریقة المخبریة التقلیدیة وتم التأکد من التشخیص باستخدام تفاعل السلسلة المتبلمرة الحقیقی عن طریق الکشف عن جین nuc الخاص بالمکورات العنقودیة الذهبیة. إضافة إلى ذلک، تم فحص نسبة وجود بعض الجینات الخاصة بالذیفانات المعویة للمکورات العنقودیة الذهبیة مثل جین الذیفان المعوی أ، جین الذیفان المعوی ب، جین الذیفان المعوی ج، جین الذیفان المعوی د، وجین الذیفان المعوی ی. وجدنا أن 12/50 (24%) من العزلات کانت موجبة للمکورات العنقودیة الذهبیة، وان کل هذه العزلات کانت تحمل واحد أو أکثر من جینات الذیفانات المعویة، مثل نوع الذیفان المعوی ج 12/12(100%) تلیها نوع الذیفان المعوی أ 7/12 (58.33%) وفقط 1/12 (8.33%) من النوع د، بینما النوع ب و ی کانا سالبین 0%. تحتوی بعض العزلات على جینات ترمز إلى نمطین من الذیفانات المعویة مثل الذیفان المعوی أ و ج 7/12 (58.33%) و ج و د 1/12(8.33%)، بینما عبّر عدد أقل من العزلات عن نمط وراثی واحد فقط من الجین المعوی ج 4/12(33.3%). أثبتت هذه الدراسة أن هناک فرصة کبیرة لحدوث سموم معویة للمکورات العنقودیة الذهبیة فی الحلیب الخام للأبقار فی مدینة بغداد.
Introduction
At the contamination of the raw milk, Staphylococcus aureus considered the most common contaminant microorganism incriminated in the staphylococcal food poisoning (1), that milk and the products derived from it may present a suitable environment for proliferating S. aureus and their enterotoxin as well, thus, passing pathogens to consumers (2). Furthermore, Staphylococcal foodborne poisoning might result from ingesting food (either milk or minced meat) containing Staphylococcal Enterotoxins SEs (3). These enterotoxins classical antigenic-based classification includes 5 classical types which are Staphylococcal Enterotoxin type A (SEA), B (SEB), C (SEC), D (SED) and E (SEE). Recently, modern SEs types which are: SEG, SEH, SEI, SEJ, SEK, SEL, SEM, SEN, SEO, SEP, SEQ, SER, and SEU, were mentioned by (4). However, SEs are small proteins with molecular weight of 26.900 - 29.600 KD (5), they are capable of resist proteolytic enzymes resulting in keeping their action in the gastro-intestinal tract. Moreover, SEs are capable of resisting heat (6), leading to retaining the biological activity even beyond pasteurization, for an example, keeping the activity of the Staphylococcal enterotoxin A (SEA) may reach 30 min at 121°C (7). These strains' SEA production properties would be strain-specific (8). Milk can be contaminated with pathogenic microorganisms carrying virulent genes with varying levels of activity (9). Many virulence factors could be produced by every strain of S. aureus, such as foodborne intoxication which produces enterotoxins (SEA to SEE) and enterotoxins (SEG to SEQ) (10). On other hand, commercial serological kits cannot detect all of the serotypes and are limited only in serotypes (A-B). Therefore, molecular techniques such as real-time polymerase chain reaction (RT-PCR) are extremely satisfied for detecting such genes of enterotoxins of Staphylococcus aureus (10).
According to the mentioned facts, the current work studied the presence of some enterotoxin genes such as (SEA, SEB, SEC, SED and SEE) in Staphylococcus aureus isolated from raw milk of cows and diagnosed with the aid of (RT-PCR) through detecting of NUC gene, which is specific forthis bacterium (11-13).
Materials and methods
50 samples of raw milk were obtained from lactating cows with some clinical signs of mastitis such asredness, hardness, or swelling of mammary glands; and changing of milk appearance. These cows were mostly crossbreed Holstein type (3-6 years old) found in different places of Baghdad city, especially in Abu Ghraib District, during the period from January to February 2021 and examined in microbiology laboratories, College of Veterinary Medicine, University of Baghdad. Directly from manually milked individual animals, after cleaning of the teats using 75% alcohol. Initially, milk streams were discarded then10 ml of each sample of milk was collected in sterile screw-cap containers and transported immediately to the laboratory for analysis.
Traditional bacterial examinations
Each sample was cultured directly onto Blood Agar for cultivation and examination of hemolytic reaction (14). A microscopic examination was done for the bacteria after staining with Gram's stain. These bacteria were also sub cultured onto MSA (Mannitol Salt Agar) as well, for isolation and identification of Staphylococcus aureus. The implanted samples were placed in the incubator at 37°C for 24 hours and then the bacteria were tested for some biochemical reactions. Conventionally, the isolates were identified using specific tests such as (Coagulase, Catalase, Phosphatase, Gelatinase, and DNase) (15).
Molecular detection using RT- PCR
DNA genome was extracted from the bacterial using the protocol of ABIOpure Extraction (ABIOpureTM Total DNA, USA), G. Tag qPCR Master Mix, Quantifluor dsDNA System (Promega, USA) while the primers, which were appropriate for this work, were from (Macrogen, Korea) as shown in (Table 1). These primers used in order to target the gene sequence specific fordetection of S. aureus (Nuc gene) and enterotoxin genes such as (SEA, SEB, SEC, SED, and SEE). The specificity of these primers were verified according to a previous work (11). Run started on (Mic qPCR Cycler, Bio Molecular System, Australia)version 2.10.0. The concentration of extracted DNA was detected, using Quantus Fluorometer, in order to evaluate the quality of samples for downstream applications. For 1 μl of DNA, 199 μl of diluted Quantifluor Dye was mixed. After 5min incubation at room temperature, DNA concentration values were detected. The primers, obtained by Macrogen Company in a lyophilized form, were dissolved in a nuclease free water to give a final concentration of 100pmol/μl as a stock solution. A working solution of these primers was prepared by adding 10μl of primer stock solution (stored at freezer -20°C) to 90μl of nuclease free water to obtain a working primer solution of 10pmol/μl. Each RT-PCR assay was performed in a total volume of 10μl of the mixture (9μl of Master mix per tube and add 1μl of Template). Master mix consisted of the forward, reverse primers and template DNA. Thermal cycling was performed at 95°C for 5 minutes as (Initial Denaturation) and 40 cycles as follows: 95°C for 15 s as (Denaturation) and 50, 53 OR 60°C for 30s as (Annealing). The extension was at 72°C for 30s.
Table 1: Primers of enterotoxin genes of S. aureus according to Çigdem et al. (11)
|
Primer Name / Sequence
|
°C
|
|
SeA F/CATTGCCCTAACGTGG
SeA R/ATCCCCTCTGAACCTTCCCATC
|
60
|
|
Seb F/TCGCATCAAACTGACAAACG
Seb R/GCAGGTACTCTATAAGTGCCTGC
|
53
|
|
Sec F/CTCAAGAACTAGACATAAAAGCTAGG
Sec R/TCAAAATCGGATTAACATTATCC
|
53
|
|
Sed F/GTGGTGAAATAGATAGGACTGC
Sed R/ATATGAAGGTGCTCTGTGG
|
60
|
|
See F/TACCAATTAACTTGTGGATAGAC
See R/CTCTTTGCACCTTACCGC
|
53
|
|
Nuc F/TGAAGTCAAATAAATCGCTTGC
Nuc R/CCCTTTTCCACTAATTCCTTATTGT
|
50
|
Results
The results of isolation and identification of S. aureus by using routine laboratory diagnostic tests showed that, out of 50 samples of raw milk of cows, 22/50 (44%) of the isolates were positive growth for Staphylococcus spp. and only 12/50 (24%) of the isolates were diagnosed as S. aureus. These isolates were confirmed by using RT-PCR when the specific gene for S. aureus (NUC gene) was detected in all isolates 12/12 (100%) (Figure 1). This study has proven that there was a high level of incidence of (S. aureus) isolates in the samples and all these bacteria were enterotoxigenic when were examined genetically by detecting the presence of enterotoxin genes using (RT-PCR). The most frequent gene was of enterotoxin type SEC 12/12 (100%) (Figure 3), followed by enterotoxin type SEA 7/12(58.33%) (Figure 2), and only 1/12 (8.33%) was found of type SED (Figure 4), while type SEB and SEE were negative 0% during detection. Two enterotoxins genes patterns carried by some isolates coding for SEA and SEC 7/12 (58.33%) and SEC and SED 1/12 (8.33%), while fewer of the isolates expressed only one genotype of enterotoxin gene like SEC 4/12 (33.3%).
Figure 1: Cycling target (Nuc) amplification curve, quantification cycle (Cq): (13.14 - 37.71).
Figure 2: Cycling target (SeA) amplification curve, quantification cycle (Cq): 37.56-43.18.
Figure 3: Cycling target (Sec) amplification curve, quantification cycle (Cq): (7.47- 35.83).
Figure 4: Cycling target (Sed) amplification curve, quantification cycle (Cq): 40.23.
Discussion
S. aureus represents one of the most famous microorganisms found in raw milk, that milk offers a suitable medium for this bacterium growth especially when decreasing of hygienic measures as well as of cooling services occurred (16). Milk contamination could be internal through infected animals’ secretion, or external due to infected persons because of the commensalism the human population and S. aureus bacteriathat approximately 50% of the people are S. aureus carriers, or might cause through the environment such as water, air, soil or dust (17). Thesemicroorganisms produce enterotoxins resulting in an important issue for public health (18,19). However, there were many staphylococcal food poisoning outbreaks occurred in some countries such as in United Kingdom (20) and one recorded in Iraq (21).
Our study has focused light on the high occurrence of enterotoxigenic S. aureus presence in raw milk of cows in Baghdad city. Out of 50 samples of the raw milk were investigated for the presence of enterotoxigenic S. aureus, using conventional and molecular methods. During the processing of dairy product, such procedures are required to reduce bacterial contamination (22). We found that only 12/50 (24%) were diagnosed as S. aureus. The level of incidence was higher than that found by one study of Hasan and Hoshyar (23) and lower when compared with other previous works such as Hayfaa et al. (24), Mansour et al. (25), Khudor et al. (26). These rates were different because of the source of milk and its being collected from infected cows. During this work, milk samples were obtained from crossbreed Holstein cows, 3-6 years old, mostly were found in Abu Ghraib District of Baghdad city.
We found that all of our isolates were positive in producing the classic enterotoxins genes, such as: enterotoxin type SEC 12/12 (100%), the occurrence level of this gene was much higher than that found by other research of Mansour et al. (25) who found that SEs genes with SEE seems to be the most frequent gene. With regard to the type SEB and SEE, they were negative detections 0% during our study. Few of the isolates produced enterotoxin type SEA 7/12 (58.33%) and only 1/12 (8.33%) was type SED. Some of these isolates had two enterotoxins’ genes patterns, such as SEA and SEC 7/12 (58.33%) and SEC and SED 1/12 (8.33%), while fewer of the isolates expressed only one genotype of enterotoxin gene as SEC 4/12(33.3%). These were the only genotyping pattern observed in our work. Future studies could be done about the occurrence of newly discovered SE gene caused by new enterotoxigenic strains for S. aureus (27).
Conclusion
This work indicated that the level of occurrence of enterotoxigenic S. aureus was very high and there were different types of enterotoxin genes carried by S. aureus isolated from raw milk samples obtained from cows in Baghdad city. This represents a potential risk for the food poisoning leading to the thought of detecting the bacteria by using a rapid and efficient technique such as RT-PCR. Few studies were found about this work, especially in Baghdad city. Therefore; further investigations are needed to detect the bacterial contamination of raw milk for the sake of consumer protection.
Acknowledgments
We would like to thank the Department of Microbiology, College of Veterinary Medicine, University of Baghdad, Iraq.
Conflict of interest
The authors declare that there are no conflicts of interest regarding the publication of this manuscript.