Isolation, identification and genetic analysis of Mannheimia haemolytica in ovine clinical mastitis in Mosul city
T.J. Rasheed1 and Dh.M. Jwher2
1Research directorate, Nineveh Agriculture directorate, Ministry of agriculture, 2Department of Veterinary Public Health, College of Veterinary Medicine, University of Mosul
[email protected], 0000-0001-9041-9945
[email protected], 0000-0002-7192-621X
Abstract
The aim of this study was to identify and diagnose of M. haemolytica strains as one of the most important causes of ovine clinical mastitis in Mosul city. One hundred and thirty-three milk samples were directly obtained from the udders of ewes infected by clinical mastitis from November 2020 to January 2021.Standard and conventional methods were followed for isolation and identification of M. haemolytica. Milk samples were cultured on blood agar 7% and MacConkey agar, then it was purified and was stained by Methylene blue. Later, different biochemical tests were Conducted. Molecular identification of M. haemolytica depending on 16srRNA gene, followed by sequencing, similarity and phylogenetic tree was generated. The results showed that 62(46.61%) of samples were positive for bacterial isolation, biochemical tests and conventional PCR technique. Sequencing results showed that the positive samples were belonged to M. haemolytica strains. The similarity within strain Ib001 and within strain 39433 were 100%, and 99.47% respectively. Poor management was associated with the high level of mastitis caused by M. haemolytica, so the application of prophylactic programs should be followed to limit the spread of the disease.
Keyword: Ovine mastitis, Mannheimia haemolytica, Mosul city
عزل وتشخیص وتحلیل وراثی للمانیمیا الحالة للدم المسببة التهاب الضرع السریری عند الأغنام فی مدینة الموصل
طارق جرجیس رشید وضیاء محمد طاهر جوهر
دائرة البحوث الزراعیة، مدیریة زراعة نینوى، وزارة الزراعة، فرع الصحة العامة البیطریة، کلیة الطب البیطری، جامعة الموصل، الموصل، العراق
الخلاصة
هدفت الدراسة الحالیة للتعرف على سلالة المانیمیا الحالة للدم المعزولة من حالات التهاب الضرع عند الأغنام. لهذا الغرض، جمعت 133 عینة من حلیب الأغنام من النعاج التی تعانی من درجات مختلفة من التهاب الضرع السریری من تشرین الثانی 2020 إلى کانون الأول 2021. اتبعت الطرق القیاسیة والتقلیدیة لتحدید وعزل المانیمیا الحالة للدم، حیث زرعت عینات الحلیب على أکار الدم بنسبة 7٪ وأکار الماکونکی، ثم صبغت بصبغة المثلین الأزرق. وأجریت علیها الاختبارات الکیموحیویة المختلفة. شخصت المانیمیا الحالة للدم جزیئیا بالاعتماد على جین 16Sr RNA وأجریت علیها عملیة تطابق وتشابه للتسلسلات الجینیة ورسم شجرة النشوء والتطور. أظهرت النتائج أن 62 عینة أی بنسبة 46.61٪ کانت موجبة للعزل الجرثومی والاختبارات الکیموحیویة وتقنیة تفاعل البلمرة المتسلسل التقلیدیة. وبینت نتائج التسلسل أن العینات الإیجابیة التی تنتمی إلى سلالات المانیمیا الحالة للدم للتطابق الجینی ان هناک تشابها ضمن عزلات السلالة Ib001 بنسبة 100٪ وعزلات السلالة 39433 بنسبة 99.47٪. ارتبط سوء الوضع الصحی بالمستوى المرتفع من حالات التهاب الضرع الذی تسببه المانیمیا الحالة للدم، لذلک یجب اتخاذ التدابیر الوقائیة والاهتمام بالممارسات الصحیة للأغنام وتطبیق البرامج الوقائیة للحد من انتشار المرض.
Introduction
Mastitis is known as inflammation of mammary glands including teats, teat canals and milk cistern of the udder. Its characterized by physical, chemical, and biological alteration of the udder and milk (1,2). Mastitis is regarded as a source of anxious for animal owners due to its adverse effect on animal hygiene and management as well as its influence on milk production, dairy manufacturing, wool and meat production. Mastitis caused by bacterial infection is the most common Infectious agents compared with other pathological agents (3,4). Several previous studies reported that subclinical and clinical mastitis caused mostly by Staphylococcus aureus (5,6). However, Mannheimia haemolytica was reported as etiological factor of subclinical and clinical mastitis in ewes (3,7). It was observed that Mannheimia hemolytica is the most important causes of mastitis of sheep (8). Mannheimia haemolytica is gram negative bacilli, non- motile, non-sporulated, the contents of G+C constitutes 39-40 % of the nuclear acid of DNA (9). M. haemolytica was considered as one of PASTEUELLA species after its re-classification by the German microbiologist Walter Mannheimia (10). It is naturally present in the upper part of the respiratory tract of ruminants. Most of common Mannheimia species are isolated from cattle, sheep and goats. Pathogenicity of M. haemolytica due to the ability of these bacteria for adhesion, presence of capsule and lipopolysaccharides, external protenous membranes iron-regulated proteins and leukotoxins. Shipping or transit fever is thought to be the main causative agent of mastitis in sheep and goats as well as the causation of pneumonia and enterotoxaemia syndromes and gangrenous mastitis in sheep and goats (11). According to the available information, there is a few studies on the role of M. haemolytica as a cause of mastitis in sheep at Mosul city. The aim of current study was to identify, diagnose and determine M. haemolytica as one of the most important causes of ovine mastitis in Mosul city.
Materials and methods
Samples collection
Initially, 13 dairy ewe’s farms, located in the Mosul city, Iraq, were selected for the milk sample collection. One hundred and thirty-three milk samples were directly obtained from the udders of sheep infected by clinical mastitis "warm, swollen, indurated, painful with abnormal milk secretion" from the period of Nov of 2020 to Jan, 2021. The milk samples were taken from the inflamed part in a sterile plastic container after the discarding the first drops of milk. Samples were put in cooled box and transported rapidly to the laboratory of veterinary public health department /college of veterinary medicine for bacteriological investigations and analysis (12).
Bacteriological investigation
Method described by Abdallah et al. (13) was followed, standard and conventional methods were followed for isolation and identification of M. haemolytica. Milk samples were cultured on blood agar 7% and MacConkey agar, then they were purified and stained by Methylene blue. Later, different biochemical tests (Indole-production, Methyl red, Voges-proskauer, Simmons Citrate, Kliglerʼs Iron Agar, Urease, Motility, Maltose, Sucrose, Mannitol, Glucose, Cytochrome oxidase, Catalase) (11).
DNA extraction
The extraction of nucleic acid from isolates of bacteria was performed according manufacture instruction using special kits supplied by (Geneaid Corporation, Taiwan).
Conventional PCR amplification of DNA
Molecular identification of M. haemolytica depending on 16srRNA gene. The DNA of the isolates bacteria were amplification using conventional PCR technique. The specific oligonucleotide primers used to amplify the bacterial 16s rRNA gene for this study (14). A total volume of PCR reaction was 25 μL which consist of: (i) 1 μL forward primer, (ii) 1 μL of reverse primer, (iii) 12.5 μL of 2×Go Taq Green Mix Master containing (1-unit Gold Star DNA polymerase, 400 μM dNTPs, 3 μM MgCl2, 20 μM (NH4) 2SO4, 75 μM Tris HCl (pH 8.5), yellow and blue dyes which function as loading dye (Promiga USA), (iv) 8 μL of nuclease-free water (Promiga USA), and (v) 2.5 μL DNA template of M. haemolytica. The mixture was placed in PCR reaction tube (Promiga USA). The DNA of M. haemolytica was amplified by using the thermocycler program which was set as the following: (i) 5 minutes at 95°C for the denaturation, (ii) 35 cycle. Where each cycle consists of denaturation (45 seconds at 94ºC); annealing (1 min. at 56ºC); and extension (1 min. ant 72ºC) and extension (1 min. at 72ºC) and (iii) 5 min.at 72ºC for the final extension (Table 1), finally, the PCR products were determined by gel electrophoresis together with DNA marker 100 bp ladder in 2% agarose gel (Bio Basic Inc., Canada).
Table 1: The utilizing PCR Primers for identification of M. haemolytica isolated from ovine mastitis.
|
Gene
|
Primer
|
Sequence (5`-3`)
|
Molecular weight
|
Reference
|
|
16srRNA
|
Forward
|
GACCTCGGTTTAGTTCACAGA
|
1350 bp
|
14
|
|
Revers
|
CACACGCTGACGCTGACCA
|
Sequencing and phylogenic analysis
From a total of 62 positive samples of M. haemolytica strains base on conventional PCR.10 PCR amplicons were submitted to (Immunogene Center, North Korea). Sequences of the DNA were analyzed by using blasted against Mannheamia GenBank sequences by using NCBI blast (BLASTn) from NCBI (http://www.ncbi.nlm.nih.gov). In addition to similarity analysis of sequences within and between our obtained sequences were preform using online multiple sequences alignment-CLUSTALW (GenomeNet) software program (http://www.genome.jp/tools-bin/clustalw) then phylogenic tree was generated ClustalX (NCBI) software programs (http://www.genome.jp/tools-bin/clustalw).
Results
The results showed that out of 133 samples, 62of them were positive 46.61% by conventional PCR technique that depended on bacterial culture of all samples obtained from ewes infected with clinical mastitis. The growth of microbial colonies of M. haemolytica on the blood agar, which were in the form of regular smooth gray colonies, with β-hemolysis surrounding and below the bacterial colonies. In McConkey agar can also be observed through its ability to ferment lactose and change the color of the medium from pink to yellow as a result of a change in the pH to acidic due to lactose fermentation. Microscopically, bacteria were stained with Methylene blue appear as a bipolar rods, and arranged either singly, in pairs, or as strings. Regarding the biochemical tests, the findings of all strains of M. haemolytica were shown in the (Table 2).
Table 2: Results of different biochemical tests for M. haemolytica colonies isolated from milk
|
Reaction
|
Result
|
|
Indole-production
|
-
|
|
Methyl red Methyl red
|
+
|
|
Voges-proskauer
|
-
|
|
Simmons citrate
|
-
|
|
Kliglerʼs Iron Agar
|
+
|
|
Urease
|
-
|
|
Motility
|
-
|
|
Maltose
|
+
|
|
Sucrose
|
+
|
|
Mannitol
|
+
|
|
Glucose
|
+
|
|
Cytochrome oxidase
|
+
|
|
Catalase
|
+
|
The current study showed that all 62 samples which were positive to standard microbiological techniques (Bacterial isolation and Biochemical tests), have been confirmed by the conventional PCR technique base on specific primers (Figure 1).
Figure 1: Amplification products for 16srRNA gene (1350 bp) of M. haemolytica. isolated from ovine mastitic milk
This study varied individual sequence analysis (BLASTn) of 10 sequences of 16SrRNA gene, 7 sequences for M. haemolytica strain Ib001 and 3 sequences for M. haemolytica strain 39433 out of 62 isolates of M. haemolytica samples. For the first time, the two strain were detected in Mosul city. The results also showed that the similarity within M. haemolytica strain Ib001 (n=7) was 100%, and the similarity within M. haemolytica strains 39433 (n=3) was 99.47%. while the similarity between two strains was from to 96.04% (Table 3).
Table 3: Similarity within and between isolated M. haemolytica strains using multiple sequence alignment-CLUSTALW
|
Category
|
Strain
|
No. of sample
|
Similarity (%)
|
|
Within strains
|
Ib001
|
7
|
100%
|
|
39433
|
3
|
99.47%
|
|
Between two strains
|
Ib001: 39433
|
7:3
|
96.04%
|
The study revealed that the homology between isolates of both M. haemolytica strain sequences obtained from acute mastitis in ewes and GenBank database demonstrated that M. haemolytica strains Ib001 (n=7) and M. haemolytica strains 39433 (n=3) were highly related 100% and 98% identity respectively with comprising to those sequences previously published of M. haemolytica strain USMARC_2286 (NC_021883.1) in USA (Figure 2 and Table 4).
Figure 2: Simplified phylogenetic tree of M. haemolytica obtained with partial sequences of 16S rRNA gene (our strains, USA strain).
Table 4: Homology between obtained sequences of M. haemolytica strains and GeneBank data
|
Sequence accession number
|
GeneBank-NCBI number
|
Query cover
|
Identity
|
Gap
|
|
Ib001
|
NC_021883.1
|
99%
|
556/558(99.64%)
|
0/558(0%)
|
|
39433
|
NC_021883.1
|
97%
|
537/558(96.04%)
|
0/555(0%)
|
Discussion
Mastitis is regarded as an important productive disease contracting ranged-reared sheep with particular concern of those dairy and nursing ewes. Several studies have approved and confirmed the effective role of M. haemolytica as a primary and crucial etiology of mastitis in sheep which similar to those caused by Staphylococcus aureus, however, the infection percentages of the former microorganism are relatively higher (2,4,15). Consequently, the current work supports such type of mastitis in sheep of Mosul city. Although the occurrence of such inflammation had significantly decreased in countries which had elaborate and developed agricultural and dairy herd manufacturing processes particularly in the last decades, it may act as challenge and obstacle in countries who’s their types of animal raising systems are classical, primitive and traditional. However, these environments and ecology hinder the development and prevention which ultimately participate in prevailing ovine mastitis (16). Apart of being an infectious disease, mastitis is regarded as an economic problem causes greater losses with unprofitable consequences in the most countries of the globe. Such harm and disadvantages are not limited to developing countries. Several hundred tons of various antibiotic remedies are used as cure, therapy and prevention of mastitis as well as production of un healthy and un wholesome milk which is harmful and unfit for human consumption (17). Mastitis is frequently related with poor hygienic practices and animal management which lead to bruising, trauma and contusion in the udder parenchyma or the teats. Damage of the udder tissue can be due to shocks, violent abnormal suckling or lactation or fly̕ s stings or other kinds of superficial wounds that affect skin providing a suitable environment or media for possible infection (9,17). Our findings were in very close to the isolation ratios recorded by others Omaleki et al (18) which reached 40.3% and 44.5% respectively. In a study carried out on approximately three thousand ewes including seventy dairy herds of England and Wales, M. haemolytica was observed as an etiology forming 40.3% (17) which was somewhat less than those recorded in the present study. In Australia, another study confirmed these findings of ovine mastitis occurrence which was 64% (15), whereas, in Netherlands, a rate of 86% was recorded in a study conducted by Radostits et al (17) on lactating ewes in the first six weeks of lactation, which is rather higher than the percentage obtained in our study.
The aforementioned workers attributed their causes to the suckling lambs that play an important role in transmitting infection because they carry the pathogen in their nasopharynx (2,15). However, the outcome of the present work is in accordance with those authors Omaleki et al (15) and Van den et al (19), who isolated and identified other species of Mannheamia (M. haemolytica, M. ruminalis and M. glucosida) from multiple cases of acute mastitis. Burriel (6) mentioned that fields, paddocks and ranges could possibly be contaminated by M. haemolytica due to previous grazing of such places by lambs infected with pneumonia caused by these bacteria with the higher probability of M. haemolytica isolation from grass, drinking water and straw bedding. The role of M. haemolytica was also referred to by Al Salihi (20). Differencing the geographical nature and the method of breeding system that depends on open grazing, unlike the animal rearing in Mosul city, which relies on semi-open grazing and sheltering, as well as the difference in temperature with subsequent impact on the incidence of M. haemolytica infection.
Nonetheless, ambient climatic conditions i.e. lowered atmospheric temperature, high relative humidity prevail in places surrounding the animals play a serious impact in maintaining, sustaining, accelerating, perpetuation or even the survival of the causative microorganisms. It was observed that such circumstances may be an additional agent for preserving the etiology of the disease with cumulative effect in places highly grazed by intensive flocks of sheep. However, these situations predispose sheep for possible mastitis (6,21). It is possible that these bacteria may establish and colonize ewe’s teats with consequent entering or later introducing of microorganisms inside the teat during suckling, nursing or lactation. The most acceptable interpretation of mastitis occurrence cases is the typical requirements of climate i.e. cool and humid weather and during grazing which is actually noticed in our study Giadinis et al(22). According Giadinis et al(22) and Bergonier et al(23), poor or unbalanced feeding may contribute in the development of mastitis particularly in ewes fed on deficient vit A and selenium rations causing lowered immunity of localized epithelial cells of the udder. These observations were confirmed by AL-bayati et al (24) who found an isolation rate of 12.8% in ovine mastitis.
Most animal suffer from these conditions especially during drought and desiccation periods reflected by malnutrition. Notably, the current investigation was carried out on the same prerequisites in which feed sources (i.e. quantity and quality) is quite rare and scarce which was apparently seen in the manifestations of the examined sheep, suffering from malnutrition. Other plausible causes of mastitis concerned with milking practice followed including rough and violent approach and handing of animal during milking such as excessive lactation, dirty and filthy udder and teats which may increase or exaggerate the condition make the udder more prone to the risks, of mammary gland infection (6,24). In the same context, exposure of the sheep to the cold weather may cause abnormal pathological lesions in the teat with subsequent increase in the bacterial counts on the teat’s skin or orifice leading to increase number of mastitis cases (24). Furthermore, the common practice of washing and rinsing of the udder with sufficient clean water is absent due to shortage of water itself or due to application or use of dirty and impure water which may produce the worse state (25). Strategic applications of udder with antibiotics should be followed in lactating female’s prior of being dry (26). Interestingly, such scientific tradition is not practiced in local farms which is regarded as an essential element of successful udder hygiene (27). This practice aims to treat inflammation occurring preceding to lactation period as well as avoidance and prevention of new udder infection in the next dry periods as recommended by other Fthenakis et al(28).
Interestingly in our results demonstrated that M. haemolytica strains Ib001 and M. haemolytica strains 39433 were highly related with M. haemolytica strain USMARC_2286 (NC_021883.1) (USA) at identity rat of 99.64% and 96.04% respectively that are proven by the results of homology and phylogenetic analysis (29). The results of this study showed that M. haemolytica strains Ib001was significantly more detected than M. haemolytica Strains 39433 in Mosul city. This result is inconsistent with previous studies in other countries Tewodros and Annania (30); Tabatabaei and Abdollahi (31), where the geographical location plays an important role in the relationship between living organisms, as the genetic types that are from similar or neighboring areas are closely related (32). Results like this could be used in designing primers for the diagnosis of M. haemolytica and vaccine production.
In the future scope of the study, the obtained findings promoted a reasonable discussion to develop acceptable principles and bases to perform farther observation for recently detected isolates. Also, such study could provide valuable information about the diversity of several strains infecting sheep dairy herd in Mosul city. Consequently, these findings may contribute to facilitate and developed efficient and practical programs for prophylaxis of ovine mastitis caused by M. haemolytica.
Conclusion
Agents predispose mastitis occurrence with M. haemolytica of sheep is probably great, particularly in nursing ewes. It is possible that these microorganisms may be transferred from the mouth cavity of the lamb to the mammary gland of ewe through nursing. There is an evidence that M. haemolytica of the udder may spread horizontally. Farm equipment and facilitates should be designed to lower the spread of the diseases i.e. altering animal surroundings and ambient circumstances. Lambs should be weaned early for possible reduction of the infections. Measures followed to reduce M. haemolytica of the respiratory tract may have preventative influence. It should be noted that there is an identity between M. haemolytica strains in the studied areas, this helps to control mastitis by vaccines manufacturing. So, precautionary steps, hygiene practice and better attention must be taken for sheep as well as the application of defensive programs to limit the spread of the disease.
Acknowledgment
The researchers extend their thanks to everyone who provided us with a helping hand and assistance in carrying out the research.
Conflict of interest
The authors reported no potential conflict of interest.