Molecular detection of ESBL/AmpC ß-Lactamase Escherichia coli isolated from sheep in Mosul city
Fatima Rafea Mahmood and Ihsan Muneer Ahmed
Department of Microbiology, College of Veterinary Medicine, University of Mosul, Mosul, Iraq
[email protected], 0000-0001-7811-3644
[email protected], 0000-0001-9698-702X, corresponding
Abstract
Globally, extended-spectrum ß-lactamase (ESBL)/Ampicillin ß-lactamase (AmpC) producing Escherichia coli has become the greatest threat for distributing antibiotic resistance. Accordingly, this study was designed to detect and screen the genes that confer resistance in E. coli isolated from sheep as main livestock in Mosul city. Forty E. coli isolates previously recovered from milk and fecal samples were included in this study. These isolates were obtained from healthy ewes, their lambs, and also from ewes with clinical mastitis. Polymerase chain reaction (PCR) was used to confirm the E. coli isolates targeting the 16sRNA gene. Furthermore, screening of different genotypes of ESBL/AmpC was conducted using specific primers. The results showed that the CTX-M gene was predominant among ESBL genotypes and recorded 40/40 (100%). While, SHV and TEM genes recorded 7/40 (17.5%) and 5/40 (12.5%), respectively. Moreover, fecal carriage of resistance genes was more than that obtained from milk in both healthy and diseased animals. However, none of the 40 isolates showed positive results for AmpC genes. The presence of different genotypes of ESBL E. coli isolated from feces or milk origin may act as a potential source for transferring antibiotic resistance to humans, other animals, and the environment.
Keywords: Escherichia coli, ESBL, AmpC, PCR, Sheep
التحری الجزیئی لجراثیم الإیشیرکیا القولونیة المنتجة لخمیرة البیتا لاکتام واسعة الطیف/الأمبسلین والمعزولة من الضأن فی مدینة الموصل
فاطمة رافع محمود و إحسان منیر احمد
فرع الأحیاء المجهریة، کلیة الطب البیطری، جامعة الموصل، الموصل، العراق
الخلاصة
على الصعید العالمی، اصبحت جراثیم الإیشیریکیا القولونیة المنتجة لانزیم البیتا لاکتام واسعة الطیف أو الأمبسلین تشکل تهدیدًا رئیسیًا لانتشار المقاومة للمضادات الحیاتیة. وبناءً على ذلک، فقد هدفت دراستا الى التحری ومسح الجینات التی تمنح المقاومة لجراثیم الإیشیریکیا القولونیة والمعزولة مسبقا من الضأن والتی تشکل جزأً أساسیا فی مدینة الموصل. تضمنت هذه الدراسة فحص أربعون عزلة من جراثیم جراثیم الإیشیریکیا القولونیة المعزولة من عینات الحلیبوالبراز. حیث تم الحصول على هذه العزلات مسبقاً من النعاج السلیمة وحملانها وکذلک من النعاج المصابة بالتهاب الضرع السریری. تم استخدام تفاعل البلمرة المتسلسل لتأکید عزلات الإیشیرکیا القولونیة بواسطة الجین 16 sRNA. علاوة على ذلک، فقد تم فحص الأنماط الجینیة المختلفة للجراثیم المنتجة لانزیم البیتا لاکتام أو الأمبسلین باستخدام مجموعة بادئات متخصصة. أظهرت النتائج أن جین CTX-M کان سائدًا بین الأنماط الجینیة للجراثیم المنتجة لأنزیم البیتا لاکتام وسجل 40/40 (100%). بینما سجلت الجینات SHV وTEM 7/40 (%17.5) و 5/40 (12.5%) على التوالی. علاوة على ذلک، فقد کان حمل الجینات المقاومة فی البراز أکثر من ذلک الذی تم الحصول علیه من الحلیب فی کل من الحیوانات السلیمة والمریضة. ومع ذلک، فلم یتم الکشف عن جینات الأمبسیلین فی أی من 40 عزلة. یعتبر وجود أنماط جینیة مختلفة من جراثیم الإیشیریکیا القولونیة المنتجة لانزیم البیتا لاکتام واسعة الطیف المعزولة من البراز أو الحلیب مصدرًا محتملًا لانتشار صفة المقاومة المضادات الحیویة للإنسان والحیوانات الأخرى والبیئة.
Introduction
Antibiotic resistance has become a significant global problem that imposes negative consequences on both human and veterinary health (1,2). Bacteria that have resistant properties could potentially pass resistance genes to other bacteria (3,4). Such conditions could increase the risk for public health by transferring antibiotic resistance through animals or the food chain (5-7). Gram-negative bacteria that can produce ESBLs and AmpC β-lactamases, are become a source of worry among health sectors because of their ability to transfer resistance and spread worldwide (1,8). Antibiotics having β-lactam ring are break up in the presence of β-lactamases, which lead to induce resistance to different generations of β-lactam based antibiotics, mainly 3rd generation cephalosporins (9,10). Hence, this results in ineffective drug treatment and is also a major reason for the failure of cephalosporin therapy (11,12). ESBLs/AmpC lactamases are most commonly produced by Escherichia coli. However, they may be produced also by other Gram-negative bacteria (3,10). Nevertheless, E. coli has emerged as a leading pathogen that mediated β-lactamases type of resistance (13,14). Resistance genes are generally mediated by plasmids including TEM, SHV, and CTX-M genes (15,16). These genes are classified as ambler class A enzyme. However, changing of amino acids sequence of the lactamase active site produces several variants of each resistance gene (17). More than 200 TEM and SHV variants have been identified, and 90 different CTX-M enzymes have been described (17). On the other hand, AmpC β- lactamases, classified as Ambler class C enzymes, are cephalosporinases that are less affected by clavulanic acid inhibitors (16). They are differentiated from other ESBLs by their ability to hydrolyze cephalosporins as well as other extended-spectrum cephalosporins (16,17). Plasmid-mediated AmpC (pAmpC) is divided into 6 families, including (CIT, FOX, MOX, DHA, EBC, and ACC) (18). In recent years, several studies have described the emergence of E. coli producing ESBL/AmpC type β-lactamases which are closely related to resistance against third and fourth-generation cephalosporins in both animals and humans (9,13). Due to the great importance of sheep farming in Iraq, and the shortage of related studies that cover the spreading of ESBL/AmpC type of resistance in sheep, the current study was designed to molecular characterize ESBL/AmpC E. coli in sheep in Iraq, specifically in Mosul city.
Materials and methods
Bacterial isolates
The study included 40 E. coli isolates. These isolates were obtained from our previous study (submitted for publication) targeting isolation of ESBL/AmpC producing E. coli from sheep. These isolates were able to grow on MacConkey agar plus cefotaxime, as third-generation cephalosporin, at a final concentration of 1µg/ml according to Ahmed (3). Also, these isolates were previously confirmed using standard microbiology methods including culture, staining, and growth on eosin methylene blue (EMB) agar (Oxoid, UK) and Vitek 2 Compact System (BioMerieux, France) according to manufacturer instructions. The obtained isolates represent milk (n=7) and fecal (n=13) samples from healthy ewes and fecal swabs (n=12) from their lambs. Additionally, milk (n=4) and fecal samples (n=4) were obtained from ewes with clinical mastitis.
DNA extraction
Few fresh overnight subculture colonies cultivated on brain heart infusion agar were selected for DNA extraction using Bacteria DNA Preparation Kit (Jena Bioscience, Germany), following the manufacturer instructions with slight modification as previously described by Ahmed (3).
Polymerase chain reaction (PCR)
Molecular confirmation of all obtained E. coli isolates was done using specific primers ECO223-F and ECO 455-R targeting the 16S rRNA gene. Furthermore, all the isolates that had phenotypic resistance to β-lactamases were screened by PCR for two sets of resistance genes. The first set represents the ESBL genes group, Including CTX-M, SHV, TEM genes. While, the second set represents the AmpC genes group, including CIT, MOX, DHA, ACC, and CMY2 genes. The primer sequences and amplified products (Table 1). All primers were purchased from (IDT, USA). Standard PCR protocol was followed for all primers except the annealing temperature. Briefly, 30 µl containing 15 µl Hot Start Taq Premix (2X) (Addbio, Korea), 0.5 µl of each forward and reverse primers (IDT, USA) at final concentration 10 mmol, 3 µl of extracted DNA, and 11 µl of PCR grade water. Thermocycler (BioRad, T100, Bio-Rad, USA) was used for amplification. The PCR cycling conditions were set (Table 2). PCR products were electrophorized using 1.5% agarose gel (Bio-Rad, USA) containing 3 µl of GelRed safe Dye (Addbio, Korea). Briefly, 5 µl of each PCR product was loaded in the respective well of the prepared agarose gel. Also, a volume of 4 µl of DNA standard marker, 100 bp (Addbio, Korea) was used to identify the obtained products. The gel running conditions and analysis were performed as previously described by Ahmed (3).
Table 1: PCR primers sequences used in the current study
|
No.
|
Primer Name
|
Sequence 5’ - 3’
|
Product size (bp)
|
Ref.
|
|
1
|
ECO223-F
|
ATCAACCGAGATTCCCCCAGT
|
232
|
(3)
|
|
2
|
ECO 455-R
|
TCACTATCGGTCAGTCAGGAG
|
|
3
|
CTX-M-Uni F
|
CGCTTTGCGATGTGCAG
|
550
|
(3)
|
|
4
|
CTX-M-Uni R
|
ACCGCGATATCGTTGGT
|
|
5
|
SHV-F
|
ATGCGTTATATTCGCCTGTG
|
763
|
(10)
|
|
6
|
SHV-R
|
TGCTTTGTTATTCGGGCCAA
|
|
7
|
TEM-F
|
AAACGCTGGTGAAAGTA
|
822
|
(10)
|
|
8
|
TEM-R
|
AGCGATCTGTCTAT
|
|
9
|
CIT-F
|
TGGCCAGAACTGACAGGCAAA
|
462
|
(13)
|
|
10
|
CIT-R
|
TTTCTCCTGAACGTGGCTGGC
|
|
11
|
MOX-F
|
GCTGCTCAAGGAGCACAGGAT
|
520
|
(13)
|
|
12
|
MOX-R
|
CACATTGACATAGGTGTGGTGC
|
|
13
|
DHA-F
|
AACTTTCACAGGTGTGCTGGGT
|
405
|
(13)
|
|
14
|
DHA-R
|
CCGTACGCATACTGGCTTTGC
|
|
15
|
ACC-F
|
AACAGCCTCAGCAGCCGGTTA
|
346
|
(13)
|
|
16
|
ACC-R
|
TTCGCCGCAATCATCCCTAGC
|
|
17
|
CMY2-F
|
CCGAAGCCTATGGCGTGAAATCC
|
106
|
(19)
|
|
18
|
CMY2-R
|
GCAATGCCCTGCTGGAGCG
|
Table 2: Cycling conditions used for amplification of PCR
|
No.
|
Step
|
Temperature
|
Time
|
No. of Cycles
|
-
|
Initial denaturation
|
94
|
10 min
|
1X
|
-
|
Denaturation
|
94
|
45 sec
|
35X
|
-
|
Primer annealing
|
*
|
45 sec
|
-
|
Elongation
|
72
|
1 min
|
-
|
Final elongation
|
72
|
10 min
|
1X
|
-
|
Hold
|
4
|
4ºC
|
∞
|
*= annealing temperature at (55ºC for E. coli, 54ºC for CTX-M-U and 45 ºC for each SHV and TEM, 60ºC for CIT, MOX, DHA, ACC, and CMY2 genes).
Results
All 40 isolates showed positive PCR results after gel electrophoresis with product size 232 bp (Figure 1). Moreover, all the isolates showed positive results for the CTX-M gene (Table 3), (Figure 2). However, the obtained results of the SHV gene were less and recorded 0.0-30.8%, while the TEM gene recorded 0.0-23.1% (Table 3) and (Figures 3,4). Additionally, fecal carriage of CTX-M, SHV, and TEM genes was higher than those present in milk (Table 3). Unfortunately, we could not detect any E. coli isolates with AmpC resistance genes including CIT, MOX, DHA, ACC, and CMY2 genes.
Table 3: PCR screening of ESBL E. coli isolated from different sources for CTX-M, SHV, and TEM genes
|
Sample type
|
No. of the tested samples
|
CTX-M n (%)
|
SHV n (%)
|
TEM n (%)
|
|
Milk (clinically healthy ewes)
|
7
|
7 (100)
|
0 (0.0)
|
1 (14.3)
|
|
Feces (clinically healthy ewes)
|
13
|
13 (100)
|
4 (30.8)
|
3 (23.1)
|
|
Feces (clinically healthy lambs)
|
12
|
12 (100)
|
2 (16.7)
|
1 (8.3)
|
|
Milk (ewes with clinical mastitis)
|
4
|
4 (100)
|
0 (0.0)
|
0 (0.0)
|
|
Feces (ewes with clinical mastitis)
|
4
|
4 (100)
|
1 (25.0)
|
0 (0.0)
|
|
Total
|
40
|
40 (100)
|
7 (17.5)
|
5 (12.5)
|
Figure 1: Electrophoresis of PCR products on the agarose gel. Lane M, DNA standard marker (100 bp); lanes 1-16 positive samples of E. coli giving 232 bp product size; lane 17 negative control.
Figure 2: Electrophoresis of PCR products on the agarose gel. Lane M, DNA ladder (100 bp); lanes 1-12 positive samples of universal CTX-M gene (550 bp); lane 13 negative control.
Figure 3: Electrophoresis of PCR products on the agarose gel. Lane M, DNA ladder (100 bp); lanes 1-7 positive samples of SHV gene (753 bp); lane 8 negative control.
M 1 2 3 4 5 6 7 8 9 10 11 12
|
Figure 4: Electrophoresis of PCR products on the agarose gel. Lane M, DNA ladder (100 bp); lanes 1, 3, 4, 5, 8 are positive samples of TEM (822 bp); lanes 2, 6, 7, 9, 10 are negative samples; lane 11 negative control.
Discussion
The spread of ESBL producing Enterobacteriaceae of both animal and human origin is growing worldwide, which causes considerable concern among medical and veterinary practitioners (11). According to our review of previous studies in Iraq, this is the first molecular conducted study to detect the presence of ESBL/AmpC producing E. coli in sheep, specifically in Mosul city. Our results proved the presence of ESBL resistance genes among all studied 40 (100%) isolates, and this was expected because of the ability of these isolates to resist cefotaxime supplemented with MacConkey agar during primary isolation (14). Furthermore, among the studied ESBL genotypes, CTX-M genotype demonstrated high rates 40 (100%) followed by SHV (17.5%) 7/40 and TEM 5/40 (12.5%) genotypes, respectively. In Iraq, few studies have documented the presence of ESBL Enterobacteriaceae. However, Al-Sharook and Hassan (20) were able to detect 23.7% (9/38) of ESBL producing E. coli that were resistant to cefpodoxime in broilers in Erbil city, Iraq. In another study by Ahmed (3) probing CTX-M gene in ESBL-producing Enterobacteriaceae in healthy dairy cattle in Mosul city, Iraq, the study reported 28.75% (23/80) of Enterobacteriaceae isolates produced ESBL and majority of the isolates belong to E. coli 82.61% (19/23). Another recent study was also conducted by Ahmed et al. (21) on shepherd dogs accompanied by sheepherders in urban areas of Mosul city. The study focused on the essential role of shepherd dogs in carrying and spreading of extended-spectrum-cephalosporin resistant E. coli (ESCR E. coli), and 53.7% (36/67) of shepherd dogs were positive for ESCR E. coli with CTX-M genotype. However, the SHV and TEM genes were not covered by these previous studies, and therefore our current study considered other than CTX-M gene, including SHV, TEM genes. Nevertheless, the CTX-M genotype is appeared to be the most common type among ESBLs compared to SHV and TEM genes (9,11). Our results were inconsistent with the findings of Pehlivanoglu et al. (22), with predominated CTX-M gene detected in 87.1% (27/31) of the isolates in cattle and 100% (3/3) isolates of sheep. However, the same study confirms the presence of TEM 77.4% (24/31) and SHV 9.7% (3/31) of cattle isolates, and TEM 66.7% (2/3) but none SHV genes of sheep isolates. Another recent study from Malaysia, by Kamaruzzaman et al. (23), reported high rates of 66.7% of ESBL producing E. coli from cattle milk with a major combination of both CTX-M and TEM genotype. In our study, we could not able to detect any AmpC group of genes, and this might be due to the limited number of bacterial isolates used. Furthermore, our results demonstrated that the fecal load of ESBL E. coli was higher than those of milk samples from both healthy and diseases ewes. These results were in agreement with other previous studies (9,23). Finally, the presence of ESBL E. coli in sheep confer great risk due to the possibility of antibiotic resistance transmission from these animals or their product to humans.
Conclusion
Sheep are considered as a potential animal source for transmission and spreading of ESBL E. coli either by milk or contaminated feces, and this could increase antibiotic therapy failure among humans and animals in the future.
Acknowledgments
The authors would like to express their great thanks to the College of Veterinary Medicine, University of Mosul, Mosul, Iraq.
Conflict of interest
No competing interests have to be declared by the authors.