Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
130
ANTI-PATHOGENIC Candida Spp. Activity DETERMINATION
VIA Lactobacillus Spp. ISOLATION AND IDENTIFICATIONS
USING CONVENTIONAL AND MOLECULAR METHODS
Hawraa F. H. AL-abedi*, Azhar A.F.AL-Attraqchi**, Bassam Y.
Khudaier***
*Department of Microbiology, College of Veterinary Medicine, University of
Basrah,basrah,Iraq.
**Department of Medical Microbiology, Collage of Medicine, Al-Nahrain
University,Baghdad, Iraq
***Department of Microbiology, College of Veterinary Medicine, University of
Basrah,Iraq.
Corresponding Author: [email protected]
Keywords: Lactobacillus, Bovine Mastitis, Candida albican.
ABSTRACT
Two Hundred and fifty samples of cow's milk from different parts of the
province of Basrah were collected from clinical and subclinical mastitis reported
using the California mastitis test between March 2018 and September 2019 and
examined using conventional PCR assay, Candida species was identified in 116/250
(46.4%). Based on conventional method and ID - Yst card system Vitek 2, Candida
albicans was the predominant 60/116 (51.7%), followed by Candida parapsilosis
15/116 (12.9%). Concerning the results of PCR amplification of 18S rRNA gene for
identification of C. albicans and C. parapsilosis, this gene was present in 60 samples
in C. albicans, and in 15 of C. parapsilosis. Lactobacillus are an industrially
important group of probiotic organisms that play an important function in human
health through inhibiting dangerous and pathogenic bacteria growth, boosting
immune function, and increasing resistance to infection. Ten out of 250(4%)
Lactobacillus isolates were obtained from apparently healthy cow milk samples.
Lactobacillus isolates were identified according to phenotypic characterization and
molecular technique using PCR (16S rRNA) and sequencing, it was seen that L.
acidophilus formed 5 isolates (50%), L.amylovorus was three (30%), while
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
131
L.crisaptus formed only two (20%) only. The results of this study revealed that the
BLAST analysis at the NCBI gene bank gave 99.39% homology with L. acidophilus,
99.19% homology with L.crispatus and 97.59% with L. amylovorus. In vitro
antimycotic activity of probiotic bacteria (Lactobacillus) against C. albicans and C.
parapsilosis using agar well diffusion methods was adapted. The cell-free neutralized
supernatant (CFS) of Lactobacilli (105,106,107) were inhibited the growth of
pathogenic C.albicans and C. parapsilosis. It was also noticed that, L. acidophilus
showed the strongest antifungal activities against pathogenic C. albicans and
C.parapsilosis with different degrees of inhibition zones in comparsion with each of
L.crispatus and L. amylovorus, meanwhile, L. amylovorus revealed strongest
antifungal activity against pathogenic C.parapsilosis.
INTRODUCTION
Bovine mastitis is a disease prompted with the aid of a wide range of
microorganisms that causes large economical loses and damages to the dairy industry
via lowering milk production and via increasing costs of antibiotic treatment and
culling (1). The incidence of mycotic mastitis is on the rise and the most often isolated
fungi from milk are Cryptococcus neoformans and Candida albicans due to extended
and indiscriminate use of antibiotics and steroids in intramammary therapy for
mastitis as nicely as the occurrence of fungal organisms on dairy farms (2). The early,
fast and correct identification of the pathogenic fungus is integral for timely, excellent
management. The traditional identification of pathogenic fungi in the clinical
microbiology laboratory is primarily based on morphological and physiological tests
frequently require three or extra days and can also be inaccurate in latest years a
multiplex PCR technique was once developed to identify concurrently multiple fungal
pathogens in a single reaction (3).
Lactic acid bacteria (LAB) are an industrially important group of bacteria and
used as starter cultures for the production of fermented milk products (yoghurt and
some cheeses) in the dairy industry. Natural habitats, which consist of the indigenous
flora of raw milk, can be an exact source of novel LAB strains with the manageable
proper properties for use raw milk are from inside the udder, the exterior of the teats
and the udder, the milking machine, the storage equipment, the housing, bedding,
feed, air and water (4). Lactic acid bacteria (Lactobacillus) are among the most
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
132
powerful prokaryotes when it comes to antimicrobial potential. A large extent of LAB
traces have effective antimycotic the pathogens with the aid of depleting vitamins
consumed by the pathogens and modulate the host immune response. In addition, they
release endogenous microbicides compounds including; lactic acid, bacitracin and
hydrogen peroxide which have microbicidal effect (5). Recently the utility of live
microorganism as potential therapeutic towards mastitis has gained interest (6).
The study aims to isolate and identify Candida spp that cause mycotic mastitis
in cows by using conventional and molecular techniques, identification of
Lactobacillus spp by molecular methods isolated from apparently healthy cow's milk
and finally evaluate the anti-Candida activity by the above isolated and diagnosed
Lactobacilli.
MATERIALS AND METHODS
1- Samples collection: Two hundred and fifty samples of bovine milk with mastitis
according to California mastitis test from different areas of Basrah province, had
collected in the course of the period from March 2018 up to September 2019. The
udder, teats orifices and milkers hands had been perfectly cleaned with tap water and
soap and disinfected with 70% ethyl alcohol before collecting milk samples. Two to
five ml of milk have been collected in clean sterile tubes after discarding the first
streams of milk to keep away from contamination, samples labeled with serial
numbers and saved at 4ᵒC in a cold box for the duration of transportation to the
laboratory to run the experiment directly (7).
2- Isolation and identification of Candida Spp
Milk samples have inoculated in Sabouraud's Dextrose agar supplemented with
0.05 mg/ml chloramphenicol and then incubated at 37ᵒC for 24h up to 1 week.
Macroscopic and microscopic morphology tests have been performed after incubation
in order to classify the genus level (8). Commercially available ID –YST card device
(Vitek 2 system, Bio Mèrieux, France for pathogenic yeast) was carried out in a range
of setting phenotyping identification tests for Candida species (9). Molecular
identification of Candida spp. in this study, with the aid of the use of conventional
PCR for the amplification of a partial gene of 18S rRNA by way of specific primer
sequences was used.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
133
3- Molecular characterization: Yeast genomic DNA from milk samples were
extracted by using G-spin DNA extraction kit according to the producer protocol.
Candida culture as 200 μl was pipetted into 1.5 ml sterile microcentrifuge tubes then
50 mg glass beads with 20 μl of proteinase K have been added and homogenized by
cell disruptor vortex mixer for 5 min. Thereafter 200 μl of BL cell lysis buffer was
added to every tube and mixed by way of vortex mixer, all tubes have been incubated
for 56ᵒC for 10 min with mixing every 3 min, 200 μl of absolute ethanol was added to
lysate and right now blended by using shaking vigorously. Spin column placed in a 2
ml collection tube and the mixture was transferred (including any precipitate) to the
column, then centrifuged at 13,000 rpm for 1 min. The filtrate used to be discarded
and the spin column used to be placed in a new 2 ml collection tube, 400 μl W1 buffer
was added to the spin column and centrifuged for 1 min at 13,000 rpm, the flowthrough
was discarded and re-used the collection tube. Six hundred μl wash buffer
was added to every column then centrifuged for 1 min at 13,000 rpm, the flowthrough
was once discarded, the column was placed into a new 2 ml collection tube,
then once more all the tubes were centrifuged for 1 min at 13,000 rpm to dry the
column membrane. The spin column was placed into a new 1.5 ml tube and 50 μl of
the buffer CE was added directly onto the membrane and incubated for 1 min at room
temperature then centrifuged for 1 min at 13,000 rpm. Then all tubes left to stand for
1 min to ensure the elution buffer was absorbed by the matrix, and then centrifuged at
10000 rpm for 30 sec to elute the purified DNA. Nano Drop spectrophotometer was
used to check the concentration of the extracted DNA in accordance to the formula:
1OD260=50ng, purity= 260/280. Oligonucleotide primers (forward and reverse) were
designed for C. albicans and Candida parapsilosis genes such as 18S rRNA, table (1).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
134
Table (1): Oligonucleotide primers used for 18S rRNA gene in Candida albicans
and Candida parapsilosis.
Species Gene Oligonucleotide Primer sequence (3ˊ-5ˊ)
Forward & reverse
Amplicon
(bp)
Genbank
Accession
number
C.albicans 18S
rRNA
F=GCCGCCAGAGGTCTAAACTT
R=AGTTCAGCGGGTAGTCCTAC
415 AB365317
C.parapsilosis 18S
rRNA
F=CTGCGGAAGGATCATTACAGA
R=TCCTCCGCTTATTGATATGCTT
507 FM172980
4- PCR amplification: PCR master mix reaction was prepared by using (Maxime
PCR premix kit i-Taq protocol). The master mix used to be organized in accordance
to the company instruction by adding three μl of template DNA, 1 μl of forward and
reverse primers (10 pmol), the volume was completed to 20 μl of nuclease-free water.
PCR machine was set up as mentioned in (table 2) for 30 cycles. PCR products have
been run on agarose gel electrophoresis for 1 hour (100V), DNA bands had been
visualized by using a gel documentation system and photographed.
Table (2): PCR program setting for Candida albicans and Candida parapsilosis
No Step C. albicans C. parapsilosis Time
1 Initial denaturation 95ᵒC 95ᵒC 2 min
2 Denaturation 95ᵒC 95ᵒC 30 sec 30
3 Annealing 59.3ᵒC 57.0ᵒC 30 sec cycles
4 Extension 72ᵒC 72ᵒC 50-60 sec
5 Final Extension 72ᵒC 5 min
6 Hold 4ᵒC 10 min
5- Isolation of Lactobacillus: Two hundred and fifty milk samples were collected
from apparently healthy cow's from different areas of Basrah province. For isolation
of Lactic acid bacteria, 1 ml of milk sample was homogenized with 9 ml sterile
distilled water for about 1-3 min aseptically. Appropriate serial dilution (10ˉ1 to 10ˉ6)
was prepared for every sample. A volume of 1ml of appropriate dilution used to be
spread on De Man, Rogosa and Sharpe agar (MRS) agar and incubated at 37ᵒC under
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
135
anaerobic conditions using a candle extinction jar with a moistened filter paper to
provide CO2, the enriched water-vapour saturated atmosphere at 37ᵒC for 48 h. Well,
isolated colonies with typical characteristics particularly pure white small (2-3 mm
diameter) with entire margin were picked up and purified by streaking two or three
times on a fresh MRS agar plate accompanied through macroscopic and microscopic
examination (10, 11).
6- Identification of Lactobacillus
Identification of Lactobacilli was performed according to their morphological,
cultural and biochemical characteristics, it is Gram-positive ranging from rods to long
slender bacilli, Catalase-negative (12).
7- Confirmation of Lactobacillus bacteria by PCR assay
A- DNA extraction: Genomic DNA of Lactobacillus (probiotic) bacteria isolates
was extracted by using FavoPrep Genomic DNA Mini bacteria kit, and done
according to the company instructions. One ml of the bacterial broth was taken to a
sterile 1.5 ml microcentrifuge tube, 200 μl lysis buffer (20 mg lysozyme) and 100 mg
cell disruptor glass beads were added and mixed by disruptor homogenizer vortex for
2 min. then, 200 μl TG1 buffer was added to each tube. The cell pellets was resuspended
by shaking vigorously with vortex mixer, and incubated at room
temperature for 10 min, all tubes were inverted every 3 min through incubation
periods, 200 μl of TG2 buffer was added to each tube and mixed by shaking
vigorously for 5 sec, all tubes were incubated at 60ºC for 10 min and inverted every
3 min through incubation period. Two hundred μl absolute ethanol was added to the
lysate and immediately mixed by shaking vigorously. A TG Mini column was placed
in a collection tube. The mixture (including any precipitate) was transferred to the TG
column, then centrifuged at 18,000 for 1 min, the TG column was placed to a new
collection tube. Four hundred μl W1 buffer was added to the TG column, then
centrifuged at 10000 rpm for 30 sec. The flow- through was discarded and the column
back in the 2 ml collection tube. Seven hundred μl wash buffer was added to the TG
column, then centrifuged at 10000 rpm for 30 sec. The flow- through was discarded
and then column back in the 2 ml collection tube. Dried TG column was transferred
to a clean 1.5 ml microcentrifuge tube and 100 μl of pre-heated elution buffer was
added to the center of the column matrix. The tubes were let stand for at least 3 min.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
136
To ensure the elution buffer was absorbed by the matrix, then centrifuged at 15,000
rpm for 30 sec, to elute the purified DNA. NanoDrop spectrophotometer was used to
check the concentration of the extracted DNA according to the formula:
1OD260=50ng, purity=260/280.
B- Oligonucleotide primer sequences: Oligonucleotide primers were designed by
NCBI- GenBank database and primer design online, and supported by (Macrogen,
Korea) company, table (3).
Table (3): Conventional PCR primers used for the detection of Lactobacillus Spp.
Genes Oligonucleotide primer sequences (5'-3'-) Product
Size (bp)
Genbank
Accession
number
16S rRNA gene
Lactobacillus spp.
F= GAAGTATCCAGAGCAAGCGGA
R= CTCGCAATTTCGCTTACGGG
550 AJ438156
C- Preparation of PCR Master Mix: PCR master mix reaction was prepared by
using (Maxime PCR premix kit i-Taq protocol). The master mix was prepared
according to the company instructions. PCR procedure was performed using the
recommended thermal cycling conditions that outlined in table (4).
Table (4): PCR program setting for Lactobacillus spp.
Step Temperature Time
Initial denaturation 95ᵒC 2 min
Repeat steps 2-4
for 29 more times
Denaturation 95ᵒC 30 sec
Annealing 59.5ᵒC 30 sec
Extraction 72ᵒC 50-60 sec
Final extension 72ᵒC 5 min
Hold 7:4ᵒC 10 min
D- DNA sequencing and phylogenetic analysis of isolated Lactobacillus: The PCR
product of 16S rRNA gene was sent to Macrogen Company in Korea for sequencing.
Phylogenetic analysis was performed according to NCBI-Blast alignment
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
137
identification and unweighted pair group method with arithmetic mean (UPGMA Tree
) in (MEGA 6.0 version).
8- In vitro antimycotic activity of probiotic bacteria (Lactobacillus spp.) against
C. albicans and C.parapsilosis using agar well diffusion methods: The sixteen
C.albicans and fifty C.parapsilosis isolates had examined for their sensitivity towards
three species of already identified probiotic Lactobacillus.
Based on a unique CFU number used to be produced for probiotic
(Lactobacillus) sterile brain heart infusion broth was placed as 9 ml in each
tube. One ml of exponentially growing bacteria broth subculture (stock) was
added to the first tube and blended well. From the first tube, one ml was once
then added to a 2nd tube and so on to obtain a tenfold serial dilution series
(10-1 to 10-7) of exponentially growing bacteria probiotic (Lactobacillus).
From every dilution, 1μl was inoculated onto MRSA and then incubated at
37ºC for 24h in the triplicate plate. The mean number of CFU used to be
counted, until the obtaining of a suspension containing 105,106,107 cells
expressed as CFU ml-1. Each species of Lactobacillus was cultured in MRS
agar of the following (105,106,107 cells expressed as CFU ml-1) where
incubated at 37 ᵒC with 5% CO2 for 18-24h, where recultured on MRS broth
and was used as the broth culture bacteria (BCB). Cell-free supernatant
(CFS) was obtained by centrifuging the culture after 24h of incubation at
10000 for 10 min. CFS for each Lactobacillus species was filtered by using
Millipore filter (0,22 μ) which is essential to prevent further growth of
bacterial cells, then neutralized to PH 7.0±0.2 by way of adding 1M NaOH.
Concerning C.albicans and C.parapsilosis they had been inoculated on
nutrient broth (NB) and incubated at 37ᵒC for 18-24h. Petri dishes containing
20 ml of nutrient agar were prepared, then inoculated with 100 μl of 24h
broth culture of C. albicans and C.parapsilosis the usage of the spread
plating method and left for 1h at room temperature, five wells have been cut
via cork pore onto the agar of every plate. Each well was filled with 50μl of
MRSB (control), culture broth of Lactobacillus, and neutralized CFS
(105,106,107) in accordance to (13). Aliquots of fresh MRSB were used as
controls for Candida and Lactobacillus species respectively, in accordance to
(14). Agar plates have been incubated at 37ᵒC for 24 h. After incubation, the
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
College of Veterinary Medicine. University of Basrah. Iraq
diameter of the inhibition zones was measured (in mm) with vernier callipers.
Isolates with clear zones less than 11 mm, 11
than 23 mm, were grouped as negative (
strong (+++) (15).
1- Isolation and identification of
One hunderd and sixteen
from milk samples of cows with mastitis based on cultural, morphological and
commercially available ID
among Candida spp was belong
C. parapsilosis 15/116 (12.9%). Molecular identification of
conventional PCR by amplification of a part of the mitochondrial gene encoding for
large subunit of 18S rRNA gene by specific primer seque
detected C. albicans and
respectively, figure (1and 2).
of the 17th International
138
11-16 mm, 17-22 mm and more
n (-), mild (+), strong (++), and very
RESULTS
C. albicans and C. parapsilosis
(46.4%) Candida isolates out of 250
ommercially –YST card system (Vitek 2 system) the highest percentage
C.albicans which was 60/116 (51.7%) followed
Candida
sequences. The yield of the
C. parapsilosis, was 60/60 (100%) and 15/15 (100%),
, Figure (1): Agarose gel
electrophoresis image shows the
PCR product analysis of pathogenic
C. albicans. Lanes M Marker
ladder (2000 bp), lane (1
SrRNA gene of C. albicans
with 415 bp. Lane (NTC): None
template (negative control).
f Conference.
), were obtained
by
spp done by
nces. , . 1-10): 18
isolate
.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
College of Veterinary Medicine. University of Basrah. Iraq
2. Isolation and identification of
Ten Lactobacilli out of 250 (4%) milk samples were isolated from appearently
healthy cows, were identified on the base of morphology
negative, long rods shaped bacilli, occurring singly or in chains, non
By molecular technique using 16S rRNA and sequencing, it was seen that
acidophilus formed 5 isolates (50%),
formed only 2 (20%). The results of
the NCBI gene bank gave 99.39% homology with
with L.crispatus and 97.59% with
bp, figure (3) and table (5).
of the 17th International
139
Lactobacillus Spp.
Gram positive, catalase
non-spore forming
y L.amylovorus was 3 (30%), while
this study revealed that the BLAST analysis at
k L. acidophilus, 99.19% homology
L. amylovorus. The amplicons size was of 550
Figure (2): Agarose gel
electrophoresis shows the PCR
product analysis of pathogenic
parapsilosis. Lanes M Marker
ladder (2000 bp), lane (1
rRNA gene of C. parapsilosis
isolate with 507 bp. Lane (NTC):
None template (negative control).
Figure (3): PCR product of
16S rRNA gene Lactobacillus
spp.. On agarose
electrophoresis. Lane 1:
Molecular size marker
(2000bp); Lanes 1-10: 16S
rRNA gene Lactobacillus spp
with 550bp; Lane NTC
(negative control).
f Conference.
forming.
L.
L.crisaptus
, C.
. 1-7): 18S
. gel
spp.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
140
Table(5): NCBI BLAST Homology sequence identity
Local Bacterial Isolates Genbank
Accession
Number
NCBIBLAST
Identical
Isolates
NCBI BLAST Homology sequence
identity
Genbank
Accession
Number
Country Identify
Lactobacillus spp. isolate
No.1
MK863556 Lactobacillus
acidophilus
MG827269.2 India 99.19
Lactobacillus spp. isolate
No.2
MK863557 Lactobacillus
amylovorus
MH819604.1 China 97.59
Lactobacillus spp. isolate
No.3
MK863558 Lactobacillus
acidophilus
MG827269.2 India 99.19
Lactobacillus spp. isolate
No.4
MK863559 Lactobacillus
crispatus
MH392998.1 China 99.39
Lactobacillus spp. isolate
No.5
MK863560 Lactobacillus
acidophilus
MG827269.2 India 99.39
Lactobacillus spp. isolate
No.6
MK863561 Lactobacillus
acidophilus
MG827269.2 India 99.17
Lactobacillus spp. isolate
No.7
MK863562 Lactobacillus
crispatus
MH392998.1 China 99.39
Lactobacillus spp. isolate
No.8
MK863563 Lactobacillus
acidophilus
MG827269.2 India 99.39
Lactobacillus sp isolate
No.9
MK863564 Lactobacillus
amylovorus
MH819604.1 China 97.81
Lactobacillus spp. isolate
No.10
MK863565 Lactobacillus
amylovorus
MH819604.1 China 97.59
3- Evaluation of antifungal activity by probiotic (Lactobacillus).
The cell-free neutralized supernatant (CFS) of Lactobacilli (105,106,107) were
inhibited the growth of pathogenic C.albicans and C.parapsilosis by well diffusion
method. It was also noticed that, L. acidophilus showed the strongest antifungal
activities against pathogenic C. albicans and C.parapsilosis with different degrees of
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
141
inhibition zones in comparsion with each of L.crispatus and L. amylovorus,
meanwhile, L. amylovorus revealed strongest antifungal activity against pathogenic
C.parapsilosis. Zone of inhibition of probiotic (Lactobacillus) against C. albicans was
compared among 105, 106 and 107 concentrations. Regarding L. acidophilus, the best
zone of inhibition was obtained at 106 concentration. L.crispatus, the best zone of
inhibition was obtained at 107 concentration. While the best inhibition zone of L.
amylovorus was obtained at 106 concentration, table (6). In case of C.parapsilosis,
zone of inhibition of probiotic was compared among 105,106 and 107 concentrations.
Regarding L. acidophilus, the best zone of inhibition was obtained at 107
concentration. In case of L. crispatus, the best zone of inhibition was obtained at 106
concentration. The best zone of inhibition was obtained at the concentration of 106 of
L. amylovorus, table (7) and figure (4).
Table (6): Zones of inhibition for Candida albicans (N= 60) with a cell free
supernatant of probiotic Lactobacillus spp.
Lactobacillus spp Concentration of probiotic (Lactobacillus) LSD T test/ p
value
105 106 107
L. acidophilus 21.92±0.7
2
33.57±2.12
25.92±1.97
2.75 -------
L.crispatus ------- 16.9±0.90
35.3±1.88
------- 8.805/0
L. amylovorus ------- 38±1.56
24.15±1.51
------- 6.030/0
LSD 0.05 ------- 2.014 1.075
T test -------
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding o
College of Veterinary Medicine. University of Basrah. Iraq
Table (7): Zones of inhibition for
supernatant of probiotic Lactobacillus
Lactobacillus spp Concentration of probiotic (Lactobacillus)
L.acidophilus
L.crispatus 19±1
L.amylovorus 15±0.57
LSD 0.05 ------
T test 3.754/0.032
A
Figure (4): The cell-free neutralized supernatant (CFS) of Lactobacilli (10
were inhibited the growth of pathogenic
diffusion method, A- C.albicans
Mastitis is the most essential health hassle in bovine dairy herds. Multifarious
microorganisms have been implicated as causative agents of bovine mastitis,
10 6
10 5
of the 17th International
142
Candida parapsilosis (N=15) with a cell free
spp.
105 106 107
----- 28.28±0.75
45±1
38.57±0.92
------
23.5±1.3
20±0.31
1.08 ------
(S)
------ 33.408/0
(S)
B
C.albicans and C.parapsilosis
+ L. amylovorus, B- C.parapsilosis + L. amylovorus.
DISCUSSION
10 7
10 5
10 6
f Conference.
LSD T test/
p value
----- 22.2333/0
(S)
----- 21.224/0
(S)
2.85 -----
105,106,107)
by well
10 7
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
143
including bacteria and fungi (16). Fungal infections of the mammary gland are usually
caused by yeast, the important genus of which is Candida (17).
A total of 116 (46.4%) Candida isolates out of 250 milk samples were collected
from cows with mastitis based on cultural, morphological and commercially available
ID –YST card system (Vitek 2 system Bio Mèrieux, France for pathogenic yeast)
were carried out in various setting phenotyping identification tests for Candida spp.
The highest percentage among isolated Candida spp. was belong C.albicans 60/116
(51.7%) followed by C. parapsilosis was 15/116 (12.9%). In the present study and
regarding the percentage of C. albicans it is agree with this of (18), who isolated
C.albicans from cattle suffering from mastitis with no response to therapy with
common antibiotic in Egypt, the proportion was 24(60%). However it is not
compatible with these results obtained by other studies done in Iraq (25%), Egypt
(29.3%) and Nigeria (24.3%) (19, 20, 21). The discrpareies in the result of the current
study with the others may come from the differences in the methods used for
diagnosis, or due to the number of included samples in the studies are not compatible
with each or due to the application hygienic of instructions different from area to
another.
In the present study the percentage of C.parapsilosis was higher than those
obtained in a study done in India were (7.69%) isolated from cows with clinical
mastitis (22). The presence of C. parapsilosis were also incompatible with those
reported in Poland which was (45%) and in Turkey as (12.7%) (17,23). The
geographical variation may considered one of the reasons of discrepancy in
distribution of species or due to the number of included samples or may due to the
differences in the methods used for diagnosis.
Molecular identification of Candida Spp. in this study, done by conventional
PCR by amplification of a part of the mitochondrial gene encoding for large subunit
of 18S rRNA gene by specific primer sequences. The yield of the detected C.
albicans and C. parapsilosis, was 60/60 (100%) and 15/15 (100%), respectively. The
result concordant with those obtained Vitek 2 system. In the present study the
percentage result of C. albicans was higher than these obtained in Egypt by (20 ) 8
(29.3%) who applied PCR using species specific primer of the 26S rRNA gene of
C.albicans involved in dairy cattle mastitis. (23), applied rapid diagnostic tests and
nested PCR method, and he obtained 46 (17.7%) positive samples for Candida spp
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
144
out of 260 mastitic milk samples by nested PCR technique 6, different species of
Candida were identified, C. tropicalis was the predominant one (26.1%), followed by
C. parapsilosis (21.7%), C. kefyr and C. krusei (17.4%) for each, C. rugosa (13%),
and C. glabrata (4.4%). These differences in the proportion of each study may come
from the difference in the primer used for PCR techniques, the discrepancy in the
number of isolates enrolled in each study, and in the skills of laboratory investigators.
PCR has increasingly used for Candida diagnosis, as it is quick, simple, specific,
sensitive and reliable (24).
Probiotics are live microorganisms which, when administered in adequate
amounts, confer a health benefit on the host (25). Some LAB species (Lactobacillus,
Streptococcus, Enterococcus and Pediococcus ) had reported as active candidates for
probiotic use in humans and animals by several researchers (26). Selection of
Lactobacilli as potential health-promoting probiotic in food and pharmaceutical
preparations entails in vitro screening for certain criteria, which include antibiotic
tolerance, bile tolerance, inhibiting the growth of other microorganisms and gastric
juice which allow them to be established in the intestinal tract. Therefore the present
study was undertaken with the objective of isolating and identifying Lactobacilli from
fermented cow milk (nono) and in vitro determination of tolerance to antibiotic, bile
and microbial inhibition (27).
Ten Lactobacilli out of 250 (4%) milk samples were isolated from appearently
healthy cows, as Gram positive, catalase negative, long rods shaped bacilli, occurring
singly or in chains, non-spore forming. By molecular technique using 16S rRNA and
sequencing, it was seen that L. acidophilus formed 5 isolates (50%), L.amylovorus
was three (30%), while L.crisaptus formed only two (20%). The results of this study
revealed that the BLAST analysis at the NCBI gene bank gave 99.39% homology
with L. acidophilus, 99.19% homology with L.crispatus and 97.59% with L.
amylovorus.
The results of the proportion of Lactobacillus in the current study is lower than
these obtained in France as (22.4%) in a study done by (28) who isolated this bacteria
from bovine mammary, each isolate was identified by sequencing the 16S rRNA
gene. In addition it is lower than the obtained in Iran (70%) which were isolated from
local dairy products (29). These differences in the results among these different
studies from the current ones mainly might come from the differences in the number
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
145
of samples enrolled, in addition to the hygienic condition, weather effect, intraspecific
variation of the isolates.
The cell-free neutralized supernatant (CFS) of Lactobacilli (105,106,107) were
inhibited the growth of pathogenic C.albicans and C.parapsilosis by well diffusion
method. It was also noticed that, L. acidophilus showed the strongest antifungal
activities against pathogenic C. albicans and C.parapsilosis with different degrees of
inhibition zones in comparsion with each of L.crispatus and L. amylovorus,
meanwhile, L. amylovorus revealed strongest antifungal activity against pathogenic
C.parapsilosis .
Zone of inhibition of probiotic (Lactobacillus) against C. albicans was compared
among 105, 106 and 107 concentrations. Regarding L. acidophilus, the best zone of
inhibition was obtained at 106 concentration. L.crispatus, the best zone of inhibition
was obtained at 107 concentration. While the best inhibition zone of L. amylovorus
was obtained at 106 concentration.
In case of C.parapsilosis, zone of inhibition of probiotic was compared among
105,106 and 107 concentrations. Regarding L. acidophilus, the best zone of inhibition
was obtained at 107 concentration. In case of L. crispatus, the best zone of inhibition
was obtained at 106 concentration. The best zone of inhibition was obtained at the
concentration of 106 of L. amylovorus.
Agar well diffusion method on SD agar plates after culture on MRS liquid
medium was achieved of selected isolates of Lactobacillus and incubated for 2 days
and cell-free culture supernatants had been aseptically separated (30). The test showed
that 4 of the 40 isolates had been fantastic in terms of antagonism towards C.albicans,
the anti- C. albicans exercise of cell-free culture supernatant was lost for the duration
of prolonged storage. No activity could be recovered after storage for 1 day at -30ᵒC.
The bad balance of anti - C. albicans activity may be to no longer only due to
irreversible precipitation- denaturation process however additionally during accidental
thawing of culture supernatant during the- freeze-drying process (31).
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
146
REFERENCES
1-Zaragoza, C.S.; Olivares, R. A. C.; Watty, A. E. D.; Moctezuma, A. D L. P.;
Tanaca, L .V. (2011). Yeasts isolation from bovine mammary glands under
different mastitis status in the Mexican High Plateu. Revista Iberoamericana de
Micología Rev. Iberoam. Micol. 28. N 2 : 79-82.
2-Rayaz, A and Darand, B.G. (2013). Present Status, Future Road Map and Diagnosis
of Zoonotic Mycotic Diseases Biomed. Pharmacol Journal 6 (2): 467-470.
3-Luo, G and Mitchell, T.H. (2002). Rapid identification of pathogenic fungi directly
from cultures by using multiplex PCR. journal of clinical microbiology : 2860-
2865.
4-Quigley, L.; O’sullivan, O.; Stanton, C.; Beresford, T. P.; Ross, R. P.; Fitzgerald,
G. F.; Cotter, P. D. (2013). The complex microbiota of raw milk. FEMS
Microbiology Reviews Vol 37(5): 664–698.
5-Magnusson, J.; Ström, K.; Roos, S.; Sjögren, J .; Schnürer, J .(2003). Broad and
complex antifungal activity among environmental isolates of lactic acid bacteria.
FEMS Microbiol. Lett. 219: 129–135.
6-Greene, G. A.; Smith, K.; Hogan, J.; Todhunter, D. (1991). Comparison of
probiotic and antibiotic intramammary therapy of cattle with elevated somatic cell
counts. Journal Dairy Sci.74: 2976-2981.
7-Radostitis, O. M.; Gay, C.C.; Hinchcliff, K.W.; Constable, P.D (2007).Veterinary
medicine,10th ed. Saunders Elsevier Philadelphia, USA. eBook ISBN:
8-Kosikowski, F.V. (1982). Culture and starters. In cheese and fermented milk foods,
2nd ed .F. V. Kosikowski and associated Brooktondale new york, NY.
9-Valenza, G.; Strasen, J.; Schäfer, F et al. (2008). Evaluation of new colorimetric
Vitek 2 yeast identification card by use of different source media. Journal Clin
Microbiol 46 (11): 3784–3787.
10-Abd El-razik, K.A.; Abdelrahman, K.A.; Abd El-moez, SH. I.; Danial, E.N.
(2011). New approach in diagnosis and treatment of bovine mycotic mastitis in
Egypt. African Journals of Microbiology Research Vol 5(31) : 5725-5732.
11-Wassie, M and Wassie, T.(2016). Isolation and identification of lactic acid bacteria
from raw cow milk. International Journal of advanced research in biological
sciences. Vol 3(8): 44-49.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
147
12-Mahdavi. S.; Isazadeh, A.; Azimian, S.H.; Bonab, N.M.; Shekar, F.; Asgharian,
A. (2017). Isolation of Lactobacillus Species from Domestic Dairy Products of
Mahabad City. Int Journal Infect. In Press:e62152.
13-Kalalou, I.; Faid, M.; and Touhami Ahami, A. (2004). Extending shelf life of fresh
minced camel meat at ambient temperature by Lactobacillus dlbrueckii subsp.
delbrueckii. Electronic Journal of Biotechnology 7: 5-6.
14-Anas, M.; Eddine, H. J.; and Mebrouk, K. (2008). Antimicrobial Activity of
Lactobacillus Species Isolated from Algerian Raw Goat’s Milk Against
Staphylococcus aureus. World Journal of Dairy and Food Sciences 3 : 39-49.
15-Rammelsberg, M. and Radler, F. (1990). Antibacterial polypeptides of
Lactobacillus species. Journal of Applied Bacteriolog. 69 : 177-184.
16-Krukowski, H.; Lisowski, A.; Rozanski, P.; Skorka, A. (2006). Yeasts and algae
isolated from cows with mastitis in the south eastern part of Poland. Pol Journal
Vet Sci 9 : 181-184.
17-Dworecka-Kaszak, B.; Krutkiewicz, A.; Szopa, D.; Kleczkowski, M.; Bieganska,
M. (2012). High prevalence of Candida yeast in milk samples from cows suffering
from mastitis in Poland. Scientific World Journal: 196-347.
18-Bakr, E.M.; Abd-Tawab, AM.; Elshemey, T.M.; Abd-elrhman, A.H. (2015).
Diagnostic and therapeutic studies on mycotic mastitis in cattle. Alexandria.
Journal Of Veterinary Science 46: 138-145.
19-Al-Ameed, A.I. (2013). Isolation and identification of fungi from infected milk
samples obtained from cattle's with mastitis and studing the antifungal activity of
rosemary ethanolic extract against the main strains. Diyala Agricultural Sciences.
20-Eldesouky, I.; Mohamed, N.; Khalaf, D.; Salama, A.; Elsify, A.; Ombarak, R.;
EL- ballal S.; Effat, M.; AL shabrawy, M. (2016). Candida mastitis in dairy
cattle with molecular detection of Candida albicans. Kafkas Univ Vet Fak Derg
22(3): 461-464.
21-Mbuk, E. U.; Kwaga, J. K. P.; Bale, J. O. O.; Umoh, J. U. (2016). Molecular
identification of yeast associated with raw cow milk from peri-urban farms in
Kaduna State, Nigeria. Academic Journals, Vol7(5) : 39-46.
22-Sukumar, K and James, P.C. (2012). Incidence of fungal mastitis in cattle.
Tamilnadu. J. Veterinary and Animal Science 8(6): 356-359.
Basrah Journal of Veterinary Research,Vol.19, No.3, 2020. Proceeding of the 17th International Conference.
College of Veterinary Medicine. University of Basrah. Iraq
148
23-Erbas, G.; Parin, U.; Kirkan, Ş.; Savaşan, S.; Őzavic, M. V.; YÜksel, H .T.
(2017). Identification of Candida strains with nested PCR in Bovein mastitis and
determination of antifungal susceptibilities. Turk Journal Vet Anim Sci 41: 757-
763.
24-Mannarelli, B.M and Kurtzman, C.P. (1998). Rapid identification of Candida
albicans and other human pathogenic yeasts by using short oligonucleotides in a
PCR. Journal Clin Microbiol 36: 1634-1641.
25-FAO/WHO, (2001). Guidelines for the evaluation of probiotics in food. Food and
Agriculture Organization of the United Nations and World Health Organization
Working Groups Report.
26-Fuller, R. (1991). Probiotics in Human Medicine. Gut 32: 439.
27-Vantsawa, P.A.; Maryah, U. T.; Timothy, B. (2017). Isolation and Identification of
Lactic Acid Bacteria with Probiotic Potential from Fermented Cow Milk (Nono) in
Unguwar Rimi Kaduna State Nigeria. American Journal of Molecular Biology 7:
99-106.
28-Bouchard, D.S.; Seridan, B.; Saraoui, T.; Rault, L.; Germon, P.; Gonzalez-
Moreno, C.; Nader-Macias, F. M.E.; Baud, D.; Fran¸cois, P.; Chuat, V.;
Chain, F.; Langella, P.; Nicoli, J.; Loir, Y.L.; Eeven, S. (2015). Lactic Acid
Bacteria Isolated from Bovine Mammary Microbiota: Potential Allies against
Bovine Mastitis. Research articl.
29- Karami, S.; Roayaei, M.; Zahedi, E.; Bahmani, M.; Mahmoodnia, L.; Hamzavi,
H.; Rafieian- Kopaei, M. (2017). Antifungal effects of Lactobacillus species
isolated from local dairy products. Int Journal Pharm Ivestig 7(2): 77-81.
30-Lertcanawanichakul, M. (2005). Isolation and Selection of Anti-Candida albicans
Producing Lactic Acid Bacteria. Walailak Journal sci & Tech 2(2): 179-187.
31-Magnusson, J. and Schnurer, J. (2001). Lactobacillus coryniformis subsp.
Coryniformis strain Si3 produce a broad- specterum proteinaceous antifungal
compound. Appl Eniron Microbiol 67 (1) : 1-5.