281
Bas.J.Vet.Res.Vol.19, No.2, 2020.
ADENOVIRUS TYPE 5 REACTIVATION IN T- LYMPHOBLAST
HUMAN CELL AFTER ETOPOSIDE TREATMENT
Zeenah Weheed Atwan
Biology department, College of Science, University of Basrah
(Received 9 March 2020,Accepted 3 April 2020 )
Key word: adenovirus, etoposide,DNA ,isolation
Corresponding author: [email protected]
ABSTRACT
Adenoviruses cause different types of human infections including, respiratory,
conjunctivitis and gastrointestinal tract infection. Despite it causes infections in both
immunocompetent and immunocompromised patients, it represents a real threat for
the latter group which makes it necessary to detect the infection, reasons underlying
reactivation and hence the appropriate treatment. The antineoplastic therapies such as
etoposide could be a compromising agent that facilitates the spread of opportunistic
infections such as adenovirus. The study aimed to assess adenovirus copy number/cell
before and after etoposide treatment. The results showed that the etoposide treatment
upregulated the replication of the virus to more than 2 fold as compared to the
untreated samples. The results revealed that the etoposide has the ability to reactivate
the virus when it starts to be latent.
INTRODUCTION
More than 50 adenovirus serotypes were identified with various types of
human diseases such as respiratory tract infection, conjunctivitis, liver and
gastrointestinal tract infection. . The virus infects both immunocompetent and
immunocompromised patients (1)
Adenovirus type 5 can infect monocyte hybridoma cell line but to a lower
extranet as compared to HeLa cells and the virus genome amplification was detected
2 days post infection. The culture survived the infection for one year with a
200copy/cell average (2).
282
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Widespread adenovirus infection confirmed in viremia and respiratory
samples from cancer patients using qPCR and the copy number of the virus genome
was assessed. The virus resulted in 75% of the infected adults and this suggests that
adenovirus could be a cause for death of immunocompromised patients (3).
In a case study, an under chemotherapy treated adult with leukemia, the
patient developed bacteria chest infection which was cured and then followed by
adenovirus pneumonia at 92 million adenovirus copy/ cell. The antiviral treatment
failed to cure the infection since the patient died with 20 million copy of adenovirus/
ml (4). Adenovirus hepatitis caused a death for 3 and a child with acute lymphoblastic
leukemia under chemotherapy when the antiviral failed in curing the infection (5).
Other fatal conditions were reported after Almetuzumab immunotherapy for
hematological malignancies adenovirus, enterovirus and Epstein Barr virus (6).
Un explained fever with Almetuzumab immunotherapy for acute lymphocytic
leukemia might be due to a fatal activated adenovirus infection (7). In a
Neuroblastoma cell line, treating cells with etoposide anti-cancer treatment induces
the cellular DNA damage which is accompanied with inducing HSV-1 promoter and
gene expression (8).Etopophos or etoposide phospahate and chemically is 4'-
Demethyl-epipodophyllo-toxin 9-[4,6-O-(R)-ethylidene-β-D-glucopyranosideis is an
antineoplastic material encouraged the reactivation of viruses such as HSV, the
analysis investigated the effect of etoposide treatment on copy number of adenovirus
type 5 in MOLT4 cell line .
MATERIALS AND METHODS
T- lymphoblast human cell line (MOLT4) was maintained at 37 ̊C, 5% CO2 in
10% FCS- Dulbecco’s Modified Eagle Medium DMEM. The cells were seeded 24
hours before infecting with human adenovirus type 5 . The cells were challenged
with the virus at moi of 5 and left for 2 days before equivalent cultures were treated
with 12.5 or 25 μM of Etoposide dissolved in DMSO and samples were harvested at
3 days post infection from treated or untreated samples to analyze the adenovirus
copy number at both treated or untreated cultures before and after the treatment.
283
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Absolute copy number assay
DNA isolation
DNA was purified by Sigma-Aldrich GenEluteTM extraction kit according the
company’s protocol and DNA yield was either directly used or stored at -20 ̊C. The
virus copy number was quantified by qPCR assay using specific primers for each
target gene, adenovirus or GAPDH (9).
Real Time Quantitative Polymerase Chain reaction
For DNA copy number analysis, 5ng of total DNA was used per reaction for
Ad5 and GAPDH plasmids, respectively and qPCR experiments were conducted
using Stratagene MX3005P light cycler (Agilent Technologies) using the following
cycling conditions: 95 ̊C for 3 mins, followed by 40 cycles of 1 min at 95 ̊C, 30 sec at
55 ̊C and 30 sec at 95 ̊C. The CTs was automatically determined by the machine
software. Adenovirus DNA copy number was quantified from standard curves of viral
genome and GAPDH plasmids.
Table-1 qPCR primers
Forward primers
5’-3’
Reverse Primer
5’-3’
Refere
nce
E1A
GTGCCCCATTAAACCAGTTG GGCGTTTACAGCTCAAGTCC (10)
GAPD
H
CCCCACACACATGCACTTACC CCTAGTCCCAGGGCTTTGATT (11)
RESULTS
With the aim of analyzing the effect of etoposide treatment on adenovirus
genome copy number in MOLT4 cells, after infecting the cells with adenovirus wt300
at moi = 5 and either treated or untreated with different concentrations of etoposide.
The analysis relied on harvesting cells over a planned time course from wt300 or
mock infected Molt4 cells.
Untreated culture and 6 days post infection showed an increase in adenovirus
copy number while the mock infected samples showed no infection. Then the copy
number started to decline in the 7th day reached to more or less 150 copy/cell.
284
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Treating the infected culture with DMSO only did not change the number of genome
copies at different time points post infection but the etoposide treatment gave different
pattern. Treating cells with 25 μM of etoposide slightly increased in the number of
virus copies reached to 200 at 1 day after treatment. Leaving the cultures for another
24 hours boosted the number of adenovirus copies close to 500 copy/ml while DMSO
or 12.5 μM did not change the number Fig 1.
Fig.1. Ad5 genome replication. Molt 4 cells were seeded at a count of 1×105 /ml for
24 hours in 75 ml flasks. Ad5 wt300 infection was achieved at moi = 5. DNA
samples were extracted from each time point (3, 6, 7,8 days post infection). Ad5
genomic copy number was quantified from standard curves of Ad5 and genomic
GAPDH plasmids made by 10 fold serial dilutions and then normalized to the control
sample value. Key labelling, WT= human adenovirus type; M= Mock infection; 5,
1D, 3D, 6D, 7D and 8D = number of days post infection; B= before treatment with
etposide; A= after treatment with etoposide; DM= DMSO; E= Etoposide.
DISCUSSION
Adenoviruses have the ability to persist in lymphoid cells achieving
appropriate modification to escape the immune response. The virus downregulates the
expression of Major histocompatibility class I. The other support that the virus obtains
is the A2 and DR53 human leukocyte antigens which provide the suitable
environment for the virus to escape the immune response (12). Serotype 1 Spread
infection was reported in a 45 years old-chronic lymphocytic leukemia woman.
285
Bas.J.Vet.Res.Vol.19, No.2, 2020.
Adenovirus was isolated from blood with a failure in developing appropriate antiadenovirus
antibodies (13).
Obviously treating adenovirus- infected lymphocytes upregulated the
replication of the virus to more than two fold and such effect didn’t belong to the
effect of DMSO since the latter samples had more or less the same number of
copies/ml compared to the corresponding samples before treatment. Topoisomerase
inhibitors have two stages of toxicity, the short includes the gastric and
myelosuppression while the long term includes the cardiac, hepatic or even secondary
leukemia (14) .
Etoposide as a chemotherapeutic agent to inhibits the activity of topisomerase
II, it was found to be a suppressor for the expression of the inflammatory cytokines
and deficiency in number of activated T lymphocytes (15). Such effect on the immune
response might ease the mission of the virus to be reactivated after treatment with
etoposide and eventually spread of the virus infection in different tissues of the body.
ACKNOWLEDGMENT
I would like to acknowledge Professor dr. K.N. Leppard for his help in this
project and his advice and feedback in the data analysis.
تنشیط العدوى بالفیروس الغدی فی خلایا نوع ٥ بعد المعاملة بالایتوبوساید فی خلایا الارومة
اللمفاویة بعد المعاملة بالایتوبوساید
زینة وحید عطوان
قسم علوم الحیاة ،کلیة العلوم ،جامعة البصرة،البصرة العراق
الخلاصة
الفایروس الغدی یسبب انواع مختلفة من العدوى للإنسان مثل عدوى الجھاز التنفسی والقناه الھضمیة
وعدوى القرنیة. وبالرغم من ان الفیروس الغدی یسبب العدوى فی المرضى ذوی الاجھزة المناعیة الطبیعة
والمنخفضة الا انھ یسبب تھدید حقیقی للمجموعة الثانیة من المرضى مما یجعل من الضروری تشخیص
الفیروس والاسباب التی تقف وراءھا وایضا وصف العلاج المناسب.تسبب العقاقیر المضادة للسرطانات مثل
مثبطات التوبوایزومیریز کالایتوبوساید تثبیط للجھاز المناعی للمرضى تحت العلاج لذا کان الھدف من الدراسة
ھو حساب عدد نسخ جینوم الفیروس الغدی قبل وبعد العلاج بترکیز مختلفة من الایتوبوساید. اظھرت النتائج بان
286
Bas.J.Vet.Res.Vol.19, No.2, 2020.
معاملة الخلایا بالایتوبوساید یزید مستوى تضاعف الفیروس الى اکثر من الضعف بعد ان بدأ تضاعف الفیروس
بالانخفاض. تظھر النتائج بان الایتوبوساید لھ القابلیة على اعادة تنشیط تضاعف الفیروس فی الخلایا اللمفاویة .
REFERENCES
1- Lion, T (2014) Adenovirus infections in immunocompetent and immunocompromised
patients. Clinical Microbiology Reviews 27, 441–462.
2- Chu, Y. Sperber, K. Myer,L. and Hsu, MT. (1992).Persistent infection of human
adenovirus type 5 in human monocyte cell lines. Virology; 188(2):793-800.
3- Lee YJ, Palomino-Guilen P, Babady NE, Lamson DM, St George K, Tang YW,
Papanicolaou GA. (2014). Disseminated adenovirus infection in cancer patients
presenting with focal pulmonary consolidation. J Clin Microbiol. 2014;52(1):350–3.
4 -Joffe, M., Wagner, S.D. & Tang, J.W. (2018). Case report: a fatal case of disseminated
adenovirus infection in a non-transplant adult haematology patient. BMC Infect Dis
18, 58. (2018).
5 -Hough R, Chetwood A, Sinfield R, Welch J, Vora A. (2005). Fatal adenovirus hepatitis
during standard chemotherapy for childhood acute lymphoblastic leukemia. J Pediatr
Hematol Oncol. 27(2):67–72.
6- Roch N., Salameire D., Gressin R., Morand, P., Epaulard O., Pavese P., Brion JP&
Stahl JP (2008). Fatal adenoviral and enteroviral infections and an Epstein-Barr
virus positive large B-cell lymphoma after alemtuzumab treatment in a patient with
refractory Sézary syndrome, Scandinavian Journal of Infectious Diseases, 40:4, 343-
346.
7- Cavalli-Bjorkman N, Osby E, Lundin J, Kalin M, OsterborgA, Gruber A. (2002). Fatal
adenovirus infection during alemtuzumab(anti-CD52 monoclonal antibody)
treatment of a patient with fludarabine-refractory B-cell chronic lymphocytic
leukaemia. Med Oncol /19:/277_80.
8 -Volcy, K & Fraser. NW.(2013). DNA damage promotes Herpes Simplex Virus-1 protein
expression in a neuroblastoma cell line. J Neurovirol.19(1): 57–64.
287
Bas.J.Vet.Res.Vol.19, No.2, 2020.
9 -Atwan, Z., Wright, J., Woodman, A., & Leppard, K. N. (2016). Promyelocytic leukemia
protein isoform II inhibits infection by human adenovirus type 5 through effects on
HSP70 and the interferon response. The Journal of general virology, 97(8), 1955–
1967.
10- Krog, G. R.,Clausen, F. B. & Dziegiel, M. H. (2007). Quantitation of RHD by real-time
polymerase chain reaction for determination of RHD zygosity and RHD
mosaicism/chimerism: an evaluation of four quantitative methods. Transfusion, 47,
715-22.
11 -Schreiner, S., Burck, C., Glass, M., Groitl, P., Wimer, P., Kinkley, S., Mund, A.,
Everett, R. D. & Dobner, T. (2013). Control of human adenovirus type 5 gene
expression by cellular Daxx/ATRX chromatin-associated complexes. Nucleic Acids
Res, 41, 3532-50.
12- Dorak, M. (1996). The implications for childhood leukemia of infection with adenovirus.
Trends Microbiol. 4:60–63
13- Ljungman, P., Ehrnst, A., Bjorkstrand, B., Juliusson, G. andLonnqvist, B. (1990).
Lethal disseminated adenovirus type1 infection in a patient with chronic
lymphocytic leukemia.Scand. J. Infect. Dis. 22:601–605.
14 -Seiter K. Toxicity of the topoisomerase II inhibitors. (2005). Expert opinion on drug
safety. 2005;4:219–234
15- Johnson TS, Terrell CE, Millen SH, Katz JD, Hildeman DA, Jordan MB.
(2014).Etoposide selectively ablates activated T cells to control the immunoregulatory
disorder hemophagocytic lymphohistiocytosis. J Immunol. 2014;192(1):84–91.