Introduction
Meat is a source of animal proteins for human being nutrition, constituting a suitable medium for the growth of many pathogens (1). It can be contaminated during slaughtering and dressing, initially dressed carcasses may be exposed to contamination by some microorganisms which may survive during meat processing and storage (2,3). The shelf life of meat is extended under good hygienic practices during storage. After chilling psychrotroph may gradually appear, the most common one is pseudomonas which is dominant in chilled meat stored under aerobic conditions (4). Before consuming meat, the proliferation of pseudomonas affects the organoleptic properties of meat, leading to the loss of the product (5). Pseudomonas strains are specific spoilage microbial species found in meat, chicken, and fish. They are recognized through the nitrogenous components that produce the volatile compounds such as ketones, aldehydes, and esters) which causes the off-flavor to appear at the spoilage point (6,7). Pseudomonas can be utilized glucose as a substrate, when the glucose is exhausted, most amino acids can be used for growth, leading to meat deterioration and becoming unacceptable to consumers (8). The significant risk of pseudomonas to consumer health is its high resistance to antimicrobials due to the impermeability of the outer membrane lipoprotein (9). Currently, molecular identification of microorganisms is widely practiced in food microbiology (10,11). Molecular detection of pseudomonas species diversity in meat is vital to provide suitable strategies for monitoring spoilage related microbiota in meat to retard its growth and extend its shelf life of meat (12).16S rRNA gene sequence analysis is used to detect pseudomonas (13). rpoB gene is also used as a target to identify the presence of p. aeruginosa as a contaminant in meat (14). The current study has focused evaluating meat contamination in Mosul city retails with psychrotrophic P. aeruginosa.
Material and methods
Ethical approval
The scientific committee of the veterinary public health department approved this work on the twelfth session at 20/June/2021.
Samples
One hundred fifty meat samples from Mosul city retail shops were collected randomly and distributed into 50 samples each of beef meat, mutton meat, and chicken meat. Meat samples were placed in the icebox and transported to the Veterinary Public Health Laboratory, College of Veterinary Medicine, University of Mosul.
Isolation and counting of pseudomonas
25 g of meat sample were added to 225 ml sterile peptone water, homogenized, and then, serial decimal dilutions were prepared; 0.1 ml of each dilution was spread on Pseudomonas cetrimide agar (PCA) (Neogen, USA). Plates were incubated at 25°C for 48 hours (15). Phenotypical characteristics were examined.
Identification of bacterial isolates
Pseudomonas species isolates were identified microscopically based on Gram staining, under a light microscope, and biochemical tests including the catalase test, oxidase test, production of Pyoverdine and growth at 42°C and 5°C were depended to confirm the identification of p. aeruginosa (16).
DNA extraction of bacterial isolates
Positive colonies of pseudomonad purified on nutrient agar were subjected to DNA extraction. Extraction of DNA was done according to the protocol of the supplying company (Jena Bioscience, Germany) suspending the selected colonies in 1.5 ml eppendrof microcentrifuge for cell lysis, centrifuge at 15,000x g for 1 minute. The supernatant was discarded, the bacterial sediment was taken, and the pellet was resuspended in 300 µl of cell lysis solution. The tubes were placed in the vortex mixer for 5 minutes and then centrifugated at 10,000 X g for one minute. The supernatant was transferred to 1.5 ml microtube containing 300 µl of absolute Isopropanol for DNA precipitation, mixed gently by inverting for 1 minute, and centrifugated at 15,000x g for 1min. The supernatant was discarded. The DNA pellets were washed by adding 500 µl of washing buffer and centrifuged at 15000× g for 1 minute, followed by supernatant elimination and drying in air at room temperature; 100 µl of Hydration Solution was added to dried DNA followed by incubating at 65°C for 60 min. to accelerate hydration. Extracted DNA was stored at -20 ̊C for further use.
Amplification of 16S rRNA gene and rpoB gene
The existence of 16S rRNA gene and rpoB gene were investigated to identify pseudomonas species. using polymerase chain reaction assay. Amplification of the 16S rRNA gene and rpoB gene were done using the forward and reverse primers according to Franzetti and Scarpellini (17),The 16S rRNA primer used in the present study with a molecular weight of 1351 bp F:5’ AGAGTTTGATCCTGGCTCAG’3; R: 5’ CTACGGCTACCTTGTTACGA’3, while the rpoB gene primer is 750 bp F: 5’ CAGTTCATGGACCAGAACAACCCG’3; R: 5’ ACGCTGGTTGATGCAGGTGTTC’3 . All components of the PCR reaction were placed in the PCR tube (Citotest, China). The total volume of a PCR reaction was 25µl. contained 2 μl of DNA, 1 μl of each primer, 12.5 μl of Master Mix 2X, and 8.5 μl of nuclease free water. The amplification reactions were performed in a thermal cycler (BioRad, T100, USA) according to the instructions of the manufactured company included initial denaturation of 10 min at 94°C followed by 35 cycles 45 sec at 94°C for denaturation, 45 sec at 55°C and 58°C for Annealing to each of 16SrRNA and rpoB generespectively, then extension of 1min at 72°C and final extension of 10 min at 72°C.The reaction was cooled at 4 °C. Separation of PCR products by electrophoresis employed 1.2% agarose gel (Promega, USA) containing prime safe dye (GeNet Bio, Korea). 5 μl of each PCR product were loaded on the wells of agarose gel. Electrophoresed in 70 volts 300 mA for 55 minutes, A volume of 4 μl of DNA ladder, 100 bp (GeNet Bio, Korea) was used as standard. The gel was captured using the Gel doc EZ system (Bio-Rad-USA) to distinguish the specific bands.
Results
Out of one hundred fifty meat samples, fifty-three Pseudomonas strains recovered at 35.33% using pseudomonas cetrimide agar distributed at 46% for beef meat, 22% for mutton, and 38% for chicken meat, the count of Pseudomonad species were 1.47*104, 1.92*104 and 21.3*104 CFU/g for beef, mutton, and chicken meat respectively (Table 1). The PCR results indicated that all pseudomonas isolates were positive for 16SrRNA gene producing product size1351 bp (Figure 1), while 21 P. aeruginosa were positive from the different types of meat at 39.62% using rpoB gene producing product size 750 bp (Figure 2).
Table 1: The prevalence of Pseudomonas species in examined meat samples
|
Type of meat sample
|
No. samples
|
No. pseudomonas spp.
|
% Isolation
|
Pseudomonas spp. CFU/g
|
|
Beef meat
|
50
|
23
|
(23/50)46
|
1.47*104
|
|
Mutton
|
50
|
11
|
(11/50) 22
|
1.92*104
|
|
Chicken meat
|
50
|
19
|
(19/50) 38
|
21.3*104
|
|
Total
|
150
|
53
|
(53/150) 35.33
|
|
Figure 1: Electrophoretic profile illustrates Lanes M, DNA marker; lane 1-12, 16SrRNA gene of pseudomonas at 1351 bp product size, lane 13 negative control.
Figure 2: Electrophoretic profile illustrates Lanes M, DNA marker; lane 1-12, rpoB gene of p. aeruginosa at 750 bpproduct size, lane 13 negative control.
Discussion
Pseudomonads are dominant organisms in meat maintained under aerobic conditions at chilled temperatures due to their distinct glucose metabolism, Pseudomonas utilize glucose as a substrate till glucose is exhausted, followed by degradation of amino acids, prevalence in meat has an environmental origin (18,19). The results revealed an essential contribution of pseudomonas species in meat. In our study the isolation rates of p. aeruginosa from chicken meat are higher than the incidence rate of p. aeruginosa recorded in meat in Samsun province obtained by Sırıken et al. (20) and less than the isolation rate indicated by Abd El-Aziz (21). The prevalence of p. aeruginosa in chicken meat could be linked to the contaminated eggs and hatcheries in conditions conducive to microbiota growth accompanied by economic problems (22,23). Our finding obtained from the isolation of pseudomonas from beef meat 46% are disagreements with the results of Hemmatet al. (24) and may be owing to metabolic variation among pseudomonas species in meat which affect the dominance of some Pseudomonas species in meat, such as P. fragi over P. lundensis and P. fluorescens due to its ability to metabolize creatine and creatinine under aerobic conditions (25). The prevalence of p. aeruginosa in beef meat can be associated with the low susceptibility to a various antimicrobial (26). The average count of pseudomonas in chicken meat is closely related to that found by Keskin and Ekmekçi(27) in chicken meat in Izmir.To overcome difficulties with culture methods using specific primer such as the rpoB gene by PCR revealed the presence of P. aeruginosa in meat (28). Our findings highlight the importance of understanding the most common pseudomonas clones in meat displayed in retail supermarkets and butcher shops and their risk to consumer health. Further research is needed to improve preservation against spoilage bacteria
Conclusion
Meat is a possible source of the potential hazard for transmitting various pathogens to the consumer, pseudomonas is a specific spoilage organism. Our results show that the prevalence of pseudomonas aeruginosa in meats may influence the keeping quality. Good hygienic measures are required to restrict the presence of such pathogens and extend the shelf life of meat to ensure meat safety.
Acknowledgments
The College of Veterinary Medicine in Mosul, Iraq, supported this research.
Conflict of interest
The authors have approved the manuscript and declare no conflict of interest.