Introduction
Fish is considered an important source of proteins, vitamins, essential amino acids, and contain rare minerals that are not found in other meats (1). Fish diseases are constituting one of the major problems in the fish industry because of the economic losses of fish due to fish mortality, cost of treatment and causing of zoonotic diseases for the fish consumer by handling (2). Contamination of rivers by fecal bacteria as a result of poor hygienic conditions and some bad people activities in addition to the deposition of untreated sewages causing a problem that concerns the fishes' quality, Moreover, unhygienic conditions of the storage and marketed places lead to increasing problems related to consumer safety of fishes (3). Escherichia coli is widely spreading in the environment as a dominant gut normal flora of humans and animals. Fish found in the natural aquatic environment harbored the pathogenic Enterobacteriaceae including E. coli (4). Therefore, it’s considered as a potential vehicle of foodborne bacterial infections, and contributed to a threat to human public health. E. coli acquired pathogenicity via virulence factors or through the spread of antibiotic resistant genes, farther that E. coli containing antibiotic resistant genes increase potentially the threat of transferring resistance of antibiotics to other strains (5). fish Contamination with extended spectrum beta lactam -bacteria may be demonstrate the risk of the persistence of these bacteria in the gut of fish (6). Recent studies indicated that E. coli that developed resistance to antibiotics particularly in fish may be transmitted to humans (7). Escherichia coli can produce extended spectrum B-lactamase (ESBL) enzymes that hydrolyze a broad spectrum of b-lactam drugs such as monobactams and cephalosporins (8). The main (ESBLs) genes are blaCTX-M, SHV, and blaTEM which induce such type of resistance (13). The increase of b-lactamase enzymes activity is derived from mutations in CTX-M, TEM and SHV genes that located on bacterial chromosomes or plasmids (9). These genes can easily be transferred horizontally, from one bacterial strain to another. ESBL-producing E. coli particularly those producing cefotaximase (CTX-M) enzymes have emerged as important pathogens causing healthcare- and community-associated infections worldwide (10,11). In the last decades, studies were increased in different countries about foods as potent sources of E. coli that produce ESBLs, such as meat, poultry, milk and other animal products. in Iraq, many reports documented these bacteria, especially in poultry meat and milk with no attention to fish as a source of ESBL-producing E. coli (12,13).
So, this study aimed to detect of ESBL-producing E. coli from the gut of Cyprinus carpio.
Materials and methods
Ethical approve
All samples were collected according to authority given from an Institutional Animal Care and Use Committee, University of Mosul, College of Veterinary Medicine according to authority no. UM.VET.2021.061.
Fish samples
A total of 75 samples of fish (Cyprinus carpio) were collected from the local fish market of Mosul city during the period between October 2021 to February 2022. each sample was placed in a sterile plastic bag and transported directly to the microbiology lab, College of Veterinary Medicine, under cooling conditions.
Isolation and identification of ESBLs E. coli
The surface of fish samples was washed with sterile saline, then the fishes were opened from the dorsal side using a sterile surgical blade then a longitudinal incision was made along the gut. Following, opened the incision and the loopful of gut contents were streaked on MacConkey agar supplemented with 2 μg/ml cefotaxime (MA+) according to (14). The inoculated plates were incubated for 24 h at 37°C. This medium is selective for the bacteria that resist to cefotaxime. All suspected colonies of ESBL E. coli were subcultured on (MA+) and Eosin methylene blue agar (EMBA) for purification. Biochemical tests including indole, methyl red, Voges- Proskauer, citrate utilization, H2S production and urease tests, were used for identification of E. coli (15).
Extraction of DNA
According to the manufactured company these ESBL E. coli isolates were subjected to genomic DNA extraction (Jena Bioscience, Germany). Fresh colonies of E. coli that cultivated on Brain Heart Infusion Agar (BHIA) for 24h at 37°C were suspended in an Eppendorf tube for the Lysis of cells, followed by a protein precipitation step. The supernatants were separated in a 1.5 ml Eppendorf microcentrifuge with 300 μl Isopropanol 99 %. Then the tubes were centrifuged and discarded the supernatant, then draining tubes. The small pellets of DNA were washed using washing buffer by inverting it several times before being centrifuged. Then the supernatant was discarded, the tubes were dried at room temperature, added 100 μl of Hydration solution for DNA hydration, and incubated at 65 °C for one hour. The extracted DNA was stored under -20 °C for the following use (12).
Detection of E. coli and their ESBL gene by PCR reaction method
All samples were screened for E. coli using specific species primers 232bp, ECO223- f (5ʹ ATCAACCGAGATTCCCCCAGT ʹ3) and ECO445-r (5ʹ TCACTATCGGTCAGTCAGGAG ʹ3) (12). The confirmation of the betalactam CTX-M gene was done using CTX-M-Uni-f (CGCTTTGCGATGTGCAG) and CTX-M-Uni-r (ACCGCGATATCGTTGGT) (16,17). While the confirmation of betalactam SHV gene was done by SHV-f (ATGCGTTATATTCGCCTGTG) and SHV-r (TGCTTTGTTATTCGGGCCAA). The PCR reaction mixture for all protocols was carried out according to the manufacturer's instructions. The master mix reaction was prepared by adding 12.5 µl of 2X Taq Premix (Ge-Net, Bio- Korea), 1 µl of each forward and reverse primers10mmol (IDT, USA), 8 µl of PCR grade water and finally 2.5 µl of the DNA template final concentration (2 ng/µl). PCR cycling conditions were done by using a thermocycler (BioRad, T100, BioRad - USA) that included one cycle at 94°C for ten min for initial denaturation, while 35cycle for 30 sec for DNA denaturation. Also 35 cycles for each annealing, extension and final extension at 1 min, 45 sec and 5 min respectively. The PCR products were separated by 1.2% of agarose gel (Promega, USA), which contained Prime Safe Dye (GeNet, Bio, Korea). The electrophoresis condition was set at 80 V, 300 mA ,50 min by using Wide Mini-Sub Cell GT gel electrophoresis systems and basic power supply (Bio-Rad, USA), A 4 µl of 100 bp DNA ladder, (GeNetBio, Korea) was used as molecular weight standard. After that, the gel was viewed using Gel doc Ez system to detect the specific bands (18,19).
Results
Through bacterial examination of 75 fish gut samples were obtained 26 isolates that belonged to the ESBL resistant E. coli with the percentage 34%. All isolates gave metallic sheen phenomenon on EMBA as shown on figure 1, and isolates were confirmed by biochemical tests, E. coli isolates gave positive results for indole and methyl red while gave negative results for each Voges- Proskauer, citrate utilization, H2S production and urease tests. ESBL producing E. coli isolates were confirmed molecularly by PCR by using ECO223-F and ECO445-R genes were give 100%positive results with 232bp band figure 2. The results showed that all ESBL producing E. coli isolates gave positive PCR application products 550 bp for universal CTXM-gene Figure 3, while all ESBL E. coli isolated in this study did not contain the SHV gene.
Figure 1: E. coli metallic sheen phenomena in eosin methylene blue agar.
Figure 2: Gel electrophoresis of PCR final products for E. coli. Lane M= 100 bp DNA marker. Well 1-12 positive E. coli samples giving, 232 bp product size. Well 13 negative controls.
Figure 3: PCR final products of universal CTX-M gene. Lane M: 100 bp DNA marker. Well 1-8 positive fish samples 550 bp product size. well 9 negative controls.
Discussion
Currently, foodborne E. coli are becoming a serious threat to public health as new strains are increasingly recorded that possess ESBLs genes. Extended-spectrum beta-lactamase-producing Escherichia coli constitutes an emerging global health problem with fish that are considered as potential reservoirs and serve as vehicles of transmission to humans and other fish due to direct contact or through shared environments (4,9).
The results of this study showed that 34% of E. coli isolates that resisted to cefotaxime when growing on MacConkey agar supplemented with cefotaxime (MA+), that belonging to ESBLs producing E. coli, this result in agreement with Nguyen et al.,2016 (20) who recorded 29.3%in fish and shrimp, and with Kumar et al.,2005 (3) who revealed that 38.8% of finfish samples from the fresh fish market that belonging to ESBLs E. coli. And disagreement with Brahmi et al. (21), Said et al. (22) and Ahmad et al. (23) who recorded 22, 2, 16, and 9.78% respectively for ESBLs E. coli from fish in different countries.The variation in these results may be belonging to the difference in the geographic distribution and/ or weather variation (24).
PCR analysis showed that all isolates under study harbored bla CTX-M genes 100%, While bla SHV gene was not detected. These results were consistence with the many studies that were done in different areas around the world such as studies of Ahmad et al. (22), Elhadi and Alsamman (25) that indicated the blaCTX-M gene is a predominate gene of ESBLs Enterobacteriaceae, especially extended spectrum cephalosporin resistant (ESCRs) producing E. coli in fish gut contents, more than other β-lactamases as SHV and TEM genes (26,16).
Most fish is affected by resistant E. coli in the aquatic environment, these bacteria either inhabit contaminated water or are found in the body of fish that are apparent normally (27). Also, industrial and hospital Sewage is another environmental contamination source of spreading ESBL E. coli to freshwater (28). Therefore, these bacteria represent a highly complex challenge between animals, humans, and environments (28), and due to the horizontal transfer of antibiotic resistance genes between strains of bacteria which facilitated the production of global health problems (29).
Conclusions
ESBLs producing E. coli were detected in fish (Cyprinus carpio) with a common CTX-M gene, SHV gene was not detected in this study. fish is considered as important source of transmission of ESBLs E. coli.
Acknowledgments
The authors would like to thanks the College of Veterinary Medicine, University of Mosul, Mosul, Iraq.
Conflict of interest
The authors declare that he has no conflict of interest.