Introduction
In Mosul, people eat a variety of meats displayed in markets, such as beef, mutton, and chicken. Improper hygienic conditions in handling and preserving meats predisposed them to spoilage because meat is a suitable medium to growth of different types of microorganisms (1,2). Proliferations of these bacterial groups lead to meat deterioration (3,4) especially psychrotrophic bacteria which can arise in meats stored aerobically at low temperature (5-7). Pseudomonas aeruginosa is one of the most common specific spoilage microorganisms in meat and meat products which make them unpalatable as a result of discoloration, off-odor, off-flavor, and slime production (8-10). Pseudomonas aeruginosa described as an opportunistic pathogen associated with health hazards (11-13). Along with skin infections, markedly contributed to a wide range of infections in many organs, including the respiratory, urinary, and gastrointestinal tracts due the presence of cell mediated virulence factors like flagella, pilli, lipopolysaccharides, exoproteases, exotoxins and phospholipase C which are frequently implicated in bacterial motility and colonization (14,15). In addition, P. aeruginosa has the ability to form biofilms which increased its resistance to antimicrobial agents (16,17). Exotoxin A is one of these virulence elements that is crucial for tissue lysis and bacterial invasion. It employs a pilus-like apparatus to release proteins into the extracellular environment, including lipase, phospholipase, alkaline phosphatase, and protease (18,19). Lecithin and lipids that contribute to tissue invasion are destroyed by the hemolysin phospholipase H (plcH) enzymes. Additionally, P. aeruginosa produces elastase B (lasB), a key player in the acute infection, and exoenzyme S (ExoS), a cytotoxin that causes harm to a variety of host cells. It’s an ADP ribosyl transferase that is secreted by the type III secretion system straight into the cytoplasm of epithelial cells (20). OprL, gene is also used as a marker to rapid identification of virulent P. aeruginosa strains (21).
Available studies about the virulence factors of P. aeruginosa in meat are not sufficient. The current study aimed to detect some virulence factors genes in P. aeruginosa isolated from beef, mutton, and chicken meat displayed in Mosul city retails using PCR technique.
Material and methods
Ethical approve
The scientific committee of the veterinary public health department approved this research on the twelfth session at 20/June/2021.
Samples
The study included twenty-one isolates of P. aeruginosa obtained from 150 samples of fresh beef, mutton and chicken meat displayed in Mosul city retails in our previous study, these isolates were distributed as 7 isolates from beef meat, 3 isolates from mutton, and 11 isolates from chicken meat, the isolates were previously confirmed using molecular detection depending on rpoB gene using polymerase chain reactions (22,23).
Isolation and identifications
P. aeruginosa isolates from meat was inoculated on brain heart infusion broth media (Himedia /Indian) and incubated at 37°C for 24hrs. Followed by inoculation of growing bacteria on cetrimide agar (Neogen/USA) then incubated overnight at 37°C to select the pure isolates of P. aeruginosa (24).
DNA extraction
Genomic DNA of P. aeruginosa. was extracted using bacterial DNA preparation kit (Gena bioscience/Germany) following the manufacturer's instructions (23).
Polymerase chain reaction (PCR)
Molecular detection of P. aeruginosa virulence genes was done using specific primers targeting some virulence genes including ToxA, ExoS, OprL and PlcH. Each virulence genes were amplified using specific primer sequences mentioned in table 1, and provided by (Macrogen/Korea). The PCR master mix reaction prepared according to kit instructions (GeNet Bio, Korea) in 20 µl total volume by adding 2 µl of purified genomic DNA, 10 of Taq Premix (2X) and 1 µl of each forward and reverse primer 10 pmol /µl then completing the PCR premix tube by PCR grade water into 20 µl and briefly mixed by. The reaction was performed in a thermocycler (BioRad, USA) for amplification by applied the following thermocycler conditions; initial denaturation temperature of 95ºC for 5 min; followed by 35 cycles at denaturation 95ºC for 45s, annealing for 45 s at 55°C for each ToxA and OprL gene while the annealing of ExoS and PlcH for 45s. at 60ºC followed by extension 72ºC for 1min and then final extension at 72ºC for 10 min. The PCR products were examined by electrophoresis in a 1.5% agarose gel (BioRad, USA), stained with 3 μl prime safe dye (GeNet Bio, Korea), 4 μl of DNA ladder, 100 bp (GeNet Bio, Korea) depended as a molecular weight standard and the gel viewed using Gel doc Ez system (BioRad, USA) to identify the specific bands.
Table 1: primers sequence for some P. aeruginosa. virulence genes
|
Primers
|
Primer’s sequence
|
ºC
|
Size (bp)
|
Genes
|
References
|
|
ExoS-F
|
GCGAGGTCAGCAGAGTATCG
|
60
|
118
|
ExoS
|
(25)
|
|
ExoS-R
|
TTCGGCGTCACTGTGGATGC
|
|
Oprl-F
|
ATGGAAATGCTGAAATTCGGC
|
55
|
504
|
oprL
|
(26)
|
|
Oprl-R
|
CTTCTTCAGCTCGACGCGACG
|
|
ToxA-F
|
GACAACGCCCTCAGCATCACCAGC
|
55
|
396
|
ToxA
|
(27)
|
|
ToxA-R
|
CGCTGGCCCATTCGCTCCAGCGCT
|
|
PlcH-F
|
GAA GCC ATG GGC TAC TTC AA
|
60
|
307
|
plcH
|
(28)
|
|
plcH-R
|
AGA GTG ACG AGG AGC GGTAG
|
Statistical analysis
Chi-square test (χ2) was used to compare the prevalence of virulence factor genes among the isolates of P. aeruginosa strains and meat type (beef, mutton, and chicken) using IBM/SPSS/Statistics/version22, USA. A value of P
Results
Results highlighted the prevalence of some virulence factors genes of P. aeruginosa. strains isolated from meat. The ToxA gene was detected in 57.14% (12/21) of isolates. The OprL gene was detected in 38.09% (8/21) of isolates. Also, PlcH gene was present in 71.42% (15/21) of P. aeruginosa. isolates. While all the isolates were negative for the exotoxin encoding S (ExoS) gene. The differences between the PlcH, OprL, and ToxA genes were statistically significant at PToxA and PlcH genes was higher in beef meat 33.33% to each of them compared to mutton and chickens’ meat while the prevalence of OprL genes was absent in mutton (Figures 1-5).
Figure 1: Prevalence of some virulence genes among P. aeruginosa. isolates from all types of meat.
Figure 2: Prevalence of some virulence genes among P. aeruginosa. isolates from beef, mutton and chicken meat
Figure 3: Electrophoretic profile illustrate Lanes M, DNA marker; lane 1-5, ToxA gene of P. aeruginosa at 396 bp product size, lane 6 negative control.
Figure 4: Electrophoretic profile illustrate Lanes M, DNA marker; lane 1-5, OprL gene of P. aeruginosa at 504 bp product size, lane 6 negative control.
Figure 5: Electrophoretic profile illustrate Lanes M, DNA marker; lane 1-4, PlcH gene of P. aeruginosa at 307 bp product size, lane 5 negative control.
Discussion
P. aeruginosa fromanimal sources involved in many tissues destruction in human beings indicated their pathogenicity which is associated with the role of some virulence factors causing serious infections (29). Virulence factors of P. aeruginosa participate withan important role in the presence and growth of these microorganisms on the surfaces and invasion of tissues with the assistance of Pillis, fimbria and polysaccharides which considered as a predisposing factor for infections (30,31). The prevalence of ToxA virulence genes in P. aeruginosa isolates from meat was relatively high while these virulence genes were absent in P. aeruginosa isolated from frozen meat (32). The prevalence of oprL genes in P. aeruginosa isolates from meat were 38.09% which disagreements with Tartor and El-Naenaeey (32) who referred to absence of these genes in frozen meat. Also, the prevalence of PLcH genes in P. aeruginosa isolates were 71.42% indicating that the isolates were capable of secreting phospholipase C and hemolytic exoenzyme which may involve in pulmonary infections (33) this percentage is relatively similar to the presence of PlcH genes in pseudomonas isolated from beef (34). The high prevalence of this gene indicated its importance in the pathogenicity of these microorganisms and its ability to induce infections with high potential risk to consumer (35,36) Meanwhile the distribution of ExoS genes in P. aeruginosa isolates from meat are negative these results were disagreed with Shahat et al. (37) who referred to the presence of these genes at 71.42% of P. aeruginosa isolatesin broilers. The detection of some virulence factors of P. aeruginosa maybe useful in early detections ofthese microorganismsin meats (38). The genetic variations in P. aeruginosa isolates from different animal sources play an important role in determination of their virulence according to source of isolates. Further studies are required to exhibit the association of P. aeruginosa virulence factors with public health especially those associated with serious respiratory and urinary infections.
Conclusion
Detection of some virulence factors genes in P. aeruginosa isolated from meat indicated the high level of pathogenicity of this microorganism which may affect the consumer health. The high prevalence of these virulence genes requires to apply hygienic conditions during the handling of meat and meat products as well as through their displaying in retails.
Acknowledgments
This study was supported by the University of Mosul's College of Veterinary Medicine in Mosul, Iraq
Conflict of interest
There are no conflicts of interest declared by the authors.