Introduction
Mastitis in cattle occurs when the udder tissue in the mammary gland becomes inflamed due to physical damage or microbial infections (1). It is the most prevalent disease that causes financial loss in the dairy industry due to a nearly 10% to 20% reduction in milk production since it has an unfavorable effect on milk ingredients, lowering its nutritional content (poor quality) and rendering it unfit for processing and consumption (2-5). Mastitis has the potential to spread zoonoses and illnesses linked to food contaminants, putting public health at risk (6). Raw milk should not be consumed directly due to the high risk of contamination with pathogenic bacteria from cattle, automatic milking machines, and milk containers (7). Therefore, milk must be pasteurized to ensure its safety and shelf life (8). Mastitis in cows can manifest itself in various forms, one of which is subclinical mastitis. Its peculiarity is that it is difficult to determine this type of disease by symptoms since they are visually absent (9,10). It is possible to diagnose subclinical mastitis according to the California test results (200,000 somatic cells per milliliter or above), since mastitis is imperceptible, and milk has a typical composition and appearance (11-13). In dairy cows, the prevalence of subclinical mastitis ranged from 15 to 76 %, while quarter involvement ranged from 5 to 45 % (14-16). Subclinical mastitis is also a constant source of barn microbial contamination and thus transmission to other animals (17). The causative agents of mastitis include a wide range of bacteria that can be contagious (e.g., Streptococcus agalactiae, Staphylococcus aureus, and Mycoplasma spp.) or environmental (e.g., Escherichia coli, Streptococcus uberis, Klebsiella pneumonia, and Enterococcus spp.) (18-21). One of the most frequent microorganisms that cause environmental mastitis is pathogenic E. coli. It commonly targets the mammary gland during the early stages of lactating, especially if left untreated. It can be fatal (22). This infection usually begins as a subclinical infection and develops into clinical mastitis in the early stages of lactation. Bredley and Graen (23) found that 51 % of clinical mastitis caused by Escherichia coli started during the dry period of dairy cows in the South-West of England.
The milk contaminated with shiga toxin-producing E. coli (STEC) can cause severe foodborne illness and significant public health issues, especially when consuming unpasteurized milk and milk products. This illness can lead to a variety of clinical manifestations ranging from mild to severe gastrointestinal symptoms to life-threatening ones, such as hemolytic uremic (HUC) and hemorrhagic colitis (HC) syndromes as a result of having many virulence genes (e.g., Stx1 and Stx2 genes) (24,25).
Given the importance of the pathogenic Escherichia coli in causing subclinical mastitis, our study aimed to determine the percentage of pathogenic Escherichia coli in milk samples during subclinical bovine mastitis in Mosul city by confirming the presence of Stx1 and Stx2 genes.
Materials and methods
Ethical approval
The scientific committee of the department of veterinary public health approved the research protocol for this study.
Milk samples collection
Four regions in the study were included in the Nineveh Governorate (Al-Nimrud, Hawi Al-Kanisa, Al-Qasr, and Al-Kogali). Eighty milk samples of cows with subclinical mastitis were obtained from November 2018 to October 2019. To diagnose the subclinical mastitis, the California Mastitis Test was applied. Throughout the sampling procedure, disposable gloves were utilized. Chlorhexidine was used to clean the teats, and 70% (v/v) ethanol was subsequently used to wipe them for sanitizing. All the chosen cows had their quarters sampled. The first two milk squirts were thrown away. Approximately ten mL of milk was collected and stored in sterile glass tubes. Within five hours, the samples were refrigerated until they were sent to the lab (Researchers Center of diagnosis of zoonotic pathogenic bacteria in the College of Veterinary Medicine, Mosul University) for bacteriological analysis.
Escherichia coli isolation and characterization
The nutrient broth was inoculated with ten microliters of milk samples and incubated at 37°C for 24 h. One loop of nutrient broth was plated on Eosin Methylene Blue Agar and MacConkey agar (LAB, United Kingdom) for the traditional culture method, and both were incubated at 37°C for 24 hours. To distinguish between E. coli and coliform, Brilliance E. coli/ coliform Agar (Oxoid, United Kingdom) was used. The biochemical assays, such as the Gram stain, Methyl Red test, Indole test, Voges-Proskauer test, Citrate Utilization test, oxidase, Triple Sugar Iron agar, and catalase were used to confirm the suspected E. coli isolates (26). Before being used for further laboratory examination, all E. coli isolates were preserved in Nutrition broth with 15% glycerol at -80°C.
Escherichia coli DNA extraction and molecular identification
The suspected E. coli were grown 24 hours at 37°C on Brilliance E. coli/ coliform agar. According to the instructions on the Dneasy Blood and Tissue Kit, deoxyribonucleic acid from E. coli was extracted (Geneaid, Korea). Using the Bio-drop device, the concentration of E. coli Deoxyribonucleic Acid was estimated before being stored at -20°C for further investigation. The isolates' uidA, Stx1, and Stx2 sequences were amplified using the PCR assay (Table 1). The total volume of the PCR reaction was 25 μL, consisting of 12.5 μL of 2xGo Taq Green Mix Master (Promega Corporation, USA), 1 μL of forward (F) and reverse I primers, 6.5 μL of nuclease-free water, and (v) 4 μL of E. coli DNA template. The entire mixture was put into a 200- μL PCR reaction tube. Three steps made up the thermocycler program: denaturation, annealing, and extension. Finally, the target sequence's amplicons were identified using a DNA marker 100 bp ladder and gel electrophoresis in a 2% agarose gel.
Table 1: PCR protocol and primers sequence for detecting E. coli genes
|
Target gene
|
Direction
|
Primer sequence 5`-3.`
|
Size of amplicon [bp]
|
PCR protocol
|
References
|
|
uidA
|
F
|
CCAAAAGCCAGACAGAGT
|
623
|
A
|
(27)
|
|
R
|
GCACAGCACZTCAAAGAG
|
|
Stx1
|
F
|
AGTTAATGTGGTGGCGAAGG
|
347
|
B
|
(28)
|
|
R
|
CACCAGACAATGTAACCGC
|
|
Stx2
|
F
|
TTCGGTATCCTATTCCCGG
|
592
|
B
|
(28)
|
|
R
|
CGTCATCGTATACACAGGAG
|
PCR protocol: A: 35 times (94°C for the 30s, 57°C for 30s, 72°C for 30s), B: 35 times (94°C for 30s, 55°C for 30s, 72°C for 30s)
Data analysis
JMP Pro16.1 software was used to perform descriptive and inferential statistics, 2021 SAS Institute Inc., North Carolina, USA (29). The Chi-square test was used to evaluate whether there was a significant relationship between the frequency of E. coli isolates and seasonal variations. The results were significant at P<0.05.
Results
According to the morphology of the colonies, the positive E. coli isolates showed up as dark pink on MacConkey agar, a metallic green sheen on EMB agar, and purple on Brilliance E. coli/coliform Agar. Additionally, all E. coli isolates were positive for the specific biochemical tests to confirm the isolates. Our research showed that the percentage of pathogenic E. coli in milk samples was 36.3% (29/80) (Table 2). Regarding the seasonal variations, no significant relationship was found between the percentage of pathogenic E. coli and the seasons (Table 2). Although there was an increase in the number of isolates in winter compared to summer, this increase was not statistically significant. Furthermore, molecular screening for a specific E. coli gene showed that all (100%) isolates possessed the uidA gene (Figure 1). PCR confirmation for the presence of Stx1 and Stx2 virulence genes revealed that 27/29 (93.1%) of the isolates had the Stx1 + Stx2 genes together, and all the isolates 100% possessed Stx2 gene (Figures 2 and 3). None of the pathogenic E. coli isolates had the Stx1 gene alone (Table 2).
Table 2: The percentage of pathogenic Escherichia coli in subclinical milk samples during different seasons
|
Season
|
No. of samples
|
No. of STEC isolates
|
Molecular detection of STEC
|
|
uidA
|
Stx1
|
Stx2
|
|
Spring
|
20
|
6a
|
6/6
|
5/6
|
6/6
|
|
Summer
|
20
|
4a
|
4/4
|
3/4
|
4/4
|
|
Autumn
|
20
|
9a
|
9/9
|
9/9
|
9/9
|
|
Winter
|
20
|
10a
|
10/10
|
10/10
|
10/10
|
|
Total
|
80
|
29 (36.3%)
|
29/29 (100%)
|
27/29 (93.1%)
|
29/29 (100%)
|
Within the same column, frequencies with similar letters are not significantly different (P > 0.05).
Figure 1: Fragment size (bp) of gene sequences: uidA (623), lane M: DNA ladder, lane 1: positive control (E. coli), lane 7: negative control, and lanes 2-6: positive samples.
Figure 2: Fragment size (bp) of gene sequences: Stx1 (347), lane M: DNA ladder, lane 1: positive control (shiga toxin-producing E. coli), lane 7: negative control, and lanes 2-6: positive samples.
Figure 3: Fragment size (bp) of gene sequences: Stx2 (592), lane M: DNA ladder, lane 1: positive control (shiga toxin-producing E. coli), lane 7: negative control, and lanes 2-6: positive samples.
Discussion
Mastitis has a severe financial impact on dairy farming all over the world. Due to the lack of visible symptoms in cases with subclinical mastitis, this is further emphasized (30). Bovine clinical and subclinical mastitis is attributed to Escherichia coli. In addition to mastitis cases, the STEC strains are commonly isolated from severe human diseases (31,32). Raw milk and unpasteurized dairy products (such as soft white cheese) are frequently consumed in Iraq’s rural areas (33). This emphasizes the possibility that milk with subclinical mastitis could play a role in introducing the bacterium into the human food chain.
Our findings confirmed the isolation of STEC from samples of cow’s milk that appeared normal (subclinical mastitis) in Mosul city. The percentage of STEC was 36.3%, which is not a small percentage and may affect public health. However, the incidence of pathogenic E. coli isolated from subclinical mastitis in bovine was 24.2, 22.6% in the previous research conducted in Iraq (Al-Sulaymaniyah) and Iran, respectively (34,35), which are lower percentage compared to our study. While our results were very close to those of the study conducted in China, the prevalence of E. coli was 34.5% in raw cow’s milk samples (36). In contrast, a much higher incidence 49.8% of pathogenic E. coli was isolated from subclinical mastitis in bovine dairy herds in Egypt (37) and Bangladesh 75% (38).
The high frequency of environmental pathogens (such as E. coli) isolated from subclinical mastitis points to poor management practices and a general lack of farm hygiene and sanitation (39). Subclinical mastitis can be prevented and controlled by either pre- or post-milking udder disinfection or by changes in milking technique, such as utilizing a milking machine (40). Dry cow therapy is essential to control subclinical mastitis since it has been proven to be successful in eradicating existing intramammary infections and preventing the development of new intramammary infections. During the dry period, this therapy usually gives intramammary or systemic antibiotics (41).
Moreover, our findings showed that Stx2 was more common than Stx1, which is consistent with STEC strains isolated from milk from cows with subclinical mastitis samples in Iran (35). Additionally, all the E. coli isolated in Egypt’s subclinical buffalo mastitis samples had the Stx2 gene (42). Furthermore, our findings supported that STEC strains isolated from cattle primarily possess the Stx2 gene, which is more closely linked to hemolytic uremic syndrome and human hemorrhagic colitis in humans (43).
Finally, our study showed no effect of season on Escherichia coli isolates in subclinical mastitis samples, which agreed with the result of the study in Iran (35). However, the results of the study conducted in Canada, Escherichia coli positive samples in clinical mastitis during the summer were more common than in the winter (44). The disparity between these studies could be explained by the fact that clinical and subclinical mastitis frequently follow seasonal patterns, possibly linked to the timing of calving and lactation in dairy cows which varies from country to country.
Conclusion
This study showed that a significant percentage of milk taken from subclinical mastitis in cows contains pathogenic E. coli, which is a possible way for zoonotic STEC transmission from cattle to humans. The high percentage of STEC carried Stx1 and Stx2 genes in milk samples in Mosul/Iraq can cause human illnesses, especially if the milk is not pasteurized. This should be considered while implementing appropriate control and preventative actions to reduce the incidence of subclinical mastitis. Furthermore, creating long-term strategies to ensure the safety of dairy cattle-derived food, such as routine screening in herds for subclinical mastitis infection to prevent loss of milk production. Since there is no automatic milking equipment in Mosul, we recommend that cow farmers regularly examine their cows using the California test for subclinical mastitis. Future research should focus on the various pathogenic etiologies that contribute to subclinical mastitis.
Acknowledgment
We want to thank all the herd owners who participated in the research. We appreciate their help.
Conflict of interest
According to the manuscript's author, no conflict of interest occurred in the writing or data analysis.