Introduction
Cases of repeat breeder are still high in Bali cattle and have become a problem in livestock development in West Nusa Tenggara. Wodaje and Mekuria (1) state that cows experiencing repeat breeder are female cows that had normal cycles and periods of lust and had been mated twice or more times with fertile males or inseminated with fertile male semen but were not pregnant. The incidence of repeat breeder in Bali cattle in West Nusa Tenggara was 24.9% of the 2,127 cases of reproductive disorders (2). The uncontrolled use of antibiotics, especially β-lactam antibiotics will pressure bacteria to mutate so that it will cause the gene encoding Extended-spectrum β-lactamase (ESBL) which has implications for the emergence of antimicrobial resistance (AMR) and has an impact on failure to treat repeat breeder cases. One of the resistance genes that is widely discussed is the β-lactamase Temoneira (blaTEM) gene in Escherichia coli which can spread to animals, humans, and the environment either by gene transfer or contamination. Antibiotic resistance genes from E. coli can occur through horizontal gene transfer. The antibiotic resistance gene’s spread can be influenced by environments with rich nutrients (3). The AMR profile of E. coli almost reflects the use of antimicrobials in food-production animals, so the emergence of the blaTEM gene in E. coli and its transmission needs attention (4). Resistance genes such as TEM (Temoneira) in Escherichia coli have been found in cattle and humans. The blaTEM in E. coli has been found in the urine of dairy cows with uterine infections in India (5). Escherichia coli producing the TEM-type ESBL gene has been found in cattle feces and the environment in Peninsular Malaysia (6). Escherichia coli that can carry two ESBL-coding genes with TEM and CTX-M types have been found in cattle farmed in Florida of the 59 E. coli isolated (7). E. coli, which is resistant to beta-lactam antibiotics such as penicillin and cefotaxime derived from cow feces, has also been reported in Lombok, West Nusa Tenggara province, but the gene encoding it has not been reported. The province of West Nusa Tenggara, which consists of the islands of Lombok and Sumbawa, is one of the provinces that are rich in smallholder livestock and is the national supplier of Bali cattle. Data from the BPS Province of West Nusa Tenggara until 2019 stated that the total population of cattle in West Nusa Tenggara was 1,234,357 heads (8). Since 2013 in East Lombok Province, there have been around 504 livestock farmer groups, and 238 of 504 livestock farmer groups were livestock groups. The high number of beginner livestock groups on the island of Lombok because there is a lack of education and knowledge about sanitation management and handling related to reproduction such as post-partum care, detection of lust, post-handling care for dystocia cases, post-treatment care for retained placenta, and uterine prolapse. It will trigger contamination of E. coli in the reproductive tract. The previous study stated that predisposing factors for repeat breeder were bacterial infection when handling cases of dystocia, retained placenta, uterine prolapse, and ovarian disorders (9). Kholik et al. (10) reported that E. coli from feces of Bali cattle with repeat breeder cases were 100% resistant to Penicillin G, and 25% were resistant to Cefotaxime of 4 samples of E. coli that have been isolated. Data stating that the number of repeat breeder cases in Bali cattle is quite high with a beginner livestock breeding system makes it very possible for the use of uncontrolled antibiotics that can cause the emergence and spread of E. coli which encodes the blaTEM gene in animals and humans. These resistance genes can spread in the human food chain either directly or indirectly because E. coli encoding the blaTEM gene may be excreted from the reproductive tract fluid, then microbial resistance genes will be disseminated to the environment and transfer-resistant genes to other bacteria (3), so research on gene character of the β-lactamase Temoneira (blaTEM) in E. coli isolated from the reproductive tract of Bali cattle is needed in anticipation of the spread of these bacteria.
This study aimed to determine the character and phylogenetic of the β-lactamase Temoneira (blaTEM) gene in E. coli isolated from the reproductive tract of Bali cattle with repeat breeder cases.
Materials and methods
Study site
This study is a descriptive cross-sectional study conducted in June 2021 on smallholder farms located in Central Lombok Regency and East Lombok Regency. In this study, 16 Bali cattle, that had repeat breeder, were used to take samples of the reproductive tract fluids of 30 Bali cattle with repeat breeder cases. The criteria for Bali cattle that experienced repeat breeder in this study were female cows with normal estrus cycles that have bred two or more times but have not conceived.
Isolation and identification of Escherichia coli
The reproductive tract fluid of Bali cattle as samples were taken using a plastic sheet gun of artificial insemination. The reproductive tract fluid of Bali cattle was collected by a qualified veterinarian from the Faculty of Veterinary Medicine, Universitas Pendidikan Mandalika, Mataram, Indonesia based on the sampling protocol of Andani et al. (11). Samples were put in Brain Heart Infusion (BHI) media and incubated for 24 hours at 37°C at the Health Testing and Calibration Laboratory of West Nusa Tenggara Province. The samples were then planted on Eosin Methylene Blue Agar (EMBA) media and incubated for 24 hours at 37°C to grow E. coli. The growing E. coli were then identified by Gram staining and biochemical tests. Biochemical tests include SIM, and fermentation of lactose, glucose, fructose & mannitol which refers to Basic laboratory procedures in clinical bacteriology (12).
Sensitivity test to antibiotics
An antibiotic susceptibility test was carried out to determine the resistance of E. coli samples to several antibiotics by disk diffusion (Oxoid LTD) on Mueller Hinton Agar using the Kirby-Bauer method. E. coli colonies were taken from the EMB medium and then put into a tube containing 0.9% NaCl and homogenized to reach the McFarland standard of 0.5. The E. coli suspension, which had reached the standard McFarland 0.5, was then swabbed on Mueller Hinton Agar and 5 types of antibiotics were planted, including penicillin G 10 U, oxytetracycline 30 ug gentamicin 10 ug, tetracycline 30 ug and cefotaxime 30 ug and incubated for 24 hours at 37°C. Sensitivity to antibiotics was carried out by measuring the diameter of the inhibition zone formed. The screening test for the presence of ESBL, using the double-disk approximation test method, used cefotaxime (CTX) 30 ug, and amoxicillin-clavulanate (AMC) 30 ug. E. coli ATCC 25922 as a negative control was used in this study. Sensitive (S), intermediate (I), and resistant (R) assessments were determined by the size of the inhibition zone formed based on the Clinical and Laboratory Standards Institute (13).
Characterization of Beta-Lactamase Gene
The molecular detection of ESBL E. coli genes was carried out by polymerase chain reaction (PCR) which was previously extracted from E. coli. Genomic DNA extraction of E. coli was performed using the QIAprep® Spin MiniprepKit procedure (Qiagen). The purity and DNA concentration was estimated using a spectrophotometer
The extracted DNA of E. coli was subjected to a polymerase chain reaction (PCR) assay by a specific primer. The specific primer was designed based on NCBI Reference Sequence: NG_050238.1 (14). The reagents for PCR were done with a total volume of 51 µL consisting of 25 µL PCR mix Dream Taq HS (Thermo®), 1.5 µL primer, 20 µL ddH2O, and 3 µL extracted DNA of E. coli as a template. The mixture was processed in the Biorad i-cycler PCR machine (Biorad system, USA). The specific primers were used in this study, for blaTEM genes forward (blaTEMF) 5' TCCTTGAGTTTTCGCCCC-3' and blaTEM genes reverse (blaTEMR) 5' CAGTGCTGCAATGATACCGC-3'' with an amplicon of 581 bp (Table 1).
The PCR conditions used were as follows: Pre-denaturation temperature 95 oC for 3 minutes, denaturation 94oC for 30 seconds, annealing 57 oC for 30 seconds, elongation 72 oC for 1 minute, and post-elongation 72 oC for 5 minutes with 35 cycles. The PCR amplicon from the blaTEM gene was electrophoresed on 2% agarose gel. The result of electrophoresis was read using the Gel Imager Biorad. American Type Culture Collection (ATCC) E. coli isolate type 25922 was used as a negative control in this study. Sequencing of PCR results was carried out at Genetic Science Indonesia.
Phylogenetic tree analysis of blaTEM gene in E. coli samples was used to determine the genetic relationship with various E. coli encoding blaTEM as references in GenBank data using the Mega X 10 software algorithm with the Neighbor-Joining method (15-17).
Table 1: Primers in detecting blaTEM genes in Escherichia coli
|
Gene
|
Primer
|
Sequence (5- 3)
|
Amplicon Size [bp]
|
Reference
|
|
blaTEM
|
Primer Forward
|
5- TCCTTGAGTTTTCGCCCC -3
|
581
|
(14)
|
|
Primer Reverse
|
5- CAGTGCTGCAATGATACCGC -3
|
Results
The results of isolation of E. coli on Eosin methylene blue Agar (EMBA) medium obtained 4 (25%) of 16 reproductive tract fluid samples of Bali cattle which were collected. The results of the research on the sensitivity test to antibiotics on 4 isolated E. coli showed that 100% E. coli is resistant to penicillin G, 75% E. coli is resistant to oxytetracycline and gentamicin, 50% E. coli is resistant to cefotaxime and 25% E. coli is resistant to tetracycline. In this study, it was also found that 50% (2/4) of E. coli was resistant to penicillin and cefotaxime (Table 2). E. coli, which was resistant to penicillin and cefotaxime showed positive synergy results by an expansion of the cefotaxime (CTX) disc diameter zone around the Amoxicillin-Clavulanate (AMC) disc in the screening test for the presence of ESBL with the double-disk approximation test method (Figure 1).
The results of the electrophoresis of the blaTEM gene PCR product on E. coli using specific primers showed that 2 samples in no. (2 and 4) of E. coli encode the blaTEM geneAmerican Type Culture Collection (ATCC) E. coli type 25922 was used as a negative control. The samples were at position 560 bp on agarose gel 2 %, while negative control did not code for the blaTEM gene (Figure 2).
Table 2: The result of the antibiotics sensitivity test of isolated E. coli
|
No.
|
Inhibition Zone Diameter (mm)
|
|
cefotaxime
|
penicillin
|
oxytetracycline
|
gentamycin
|
tetracycline
|
|
1
|
40 S
|
0 R
|
0 R
|
18S
|
16 S
|
|
2
|
36 S
|
0 R
|
24 S
|
0 R
|
20 S
|
|
3
|
10 R
|
0 R
|
0 R
|
0 R
|
0 R
|
|
4
|
12 R
|
0 R
|
0 R
|
0 R
|
0 R
|
S= susceptible, I= Intermediate, R= Resistant
Figure 1: Double-disk approximation Synergy test on Escherichia coli. a= E. coli ATCC 25922. b= sample 1, c= sample 1, AMC= amoxicillin-clavulanate; CTX= cefotaxime;(arrow) = Synergy
Figure 2: 2% of agarose gel electrophoresis shows 2 samples in no. (2 and 4) of E. coli encode the blaTEM gene. M is the DNA marker, the sample is in lanes: 1-4, and K is E. coli ATCC 25922.
The results of the sequencing of the blaTEM gene from the E. coli samples in Figure 3 were then analyzed phylogenetically to determine the relationship with several E. coli encoding the blaTEM gene originating from humans, animals, and the environment in the data in GenBank. The data in GenBank used include Code (NG_050238, MT387477.1, MG653169.1, MT789719.1, and code MW1838931). The results of the phylogenetic analysis for the blaTEM gene in Escherichia coli from the Bali cattle reproductive tract had a genetic relationship with the reference in GenBank, namely Code NG_050238.1 with bootstraps 97% and also with Code MW183897.1 and Code MT789719.1. Bootstraps' value of 97% indicates a high value and a strong relationship (Figure 3). Code NG_050238.1 is E. coli S2.2-EK pEC-S2.2 blaTEM gene for class A broad-spectrum beta-lactamase TEM-206. The codes NG_050238.1 and MT789719.1 are E. coli blaTEM-1 isolated from pigs. Code MW183897.1 is E. coli strain U-10 TEM family beta-lactamase from human feces and urine.
Figure 3: Phylogenetic analysis of the blaTEM gene on E. coli samples with data from GenBank. 2R-TTEM: Sample of E. coli; (NG_050238.1, MT387477.1, MG653169.1, MT789719.1, MW183893.1, and KX871187.1): Data reference in GenBank.
Discussion
The results of the isolation of E. coli on eosin methylene blue agar (EMB) obtained 4 (25%) of 16 reproductive tract fluid samples of Bali cattle that had been collected. These results are close to the results of the previous study, which stated that 33.33% (3/10) of E. coli were found in 10 isolates of Gram-negative bacteria in repeat breeder cattle in Aceh (9). Research on Bali cattle in Lombok also documented the presence of E. coli, Citrobacter freundii, and Proteus vulgaris bacteria in 4 samples of reproductive tract fluid from Bali cattle that experienced repeat breeder (18).
Escherichia coli isolates were resistant to penicillin G, oxytetracycline and gentamicin, cefotaxime, and tetracycline and also showed positive synergy results by an expansion of the cefotaxime (CTX) disc diameter zone around the amoxicillin-clavulanate (AMC) disc in the screening test for the presence of ESBL with the double-disk approximation test. These facts show that E. coli resistance has occurred to various antibiotics used in the treatment of repeat breeder cases in Bali cattle. Poorly controlled administration of antibiotics will cause E. coli bacteria to adapt to produce genes encoding extended-spectrum β-lactamase (ESBL) found on chromosomes and plasmids. These results are in line with the statement that the AMR profile of E. coli almost reflects the use of antimicrobials in animals for food production (4). E. coli has also been isolated from Bali cattle which are resistant to erythromycin, tetracycline, and ciprofloxacin (19). Kholik et al. (10) also found that E. coli from the feces of Bali cattle with repeat breeder cases on Lombok Island were resistant to penicillin G, oxytetracycline, and cefotaxime.
The PCR results of the blaTEM gene on E. coli from samples, isolated from the reproductive tract of Bali cattle in this study, were at a position of 560 bp on the agarose band electrophoresis. The result of this study is in line with several studies documenting the position of the blaTEM gene in the agarose band. Previous research had stated that blaTEM isolated Escherichia coli from the urine of dairy cows with uterine infection in India at 800 bp (5). The blaTEM gene in Escherichia coli was also found in dairy cows to be at around 500 bp (6)
Based on the phylogenetic analysis in figure 3, E. coli encoding the blaTEM gene were obtained from the reproductive tract of Bali cattle and had a genetic relationship with E. coli blaTEM-206 that isolated from pig and had a genetic relationship with E. coli (Escherichia coli strain U-10 TEM family beta-lactamase gene) from stool and urine of humans. This situation can happen because the reproductive tract is contaminated by E. coli through humans or the environment. The previous research documented that predisposing factors for repeat breeder were bacterial infection when handling cases of reproductive disorders in cattle like dystocia, retained placenta, uterine prolapse, and ovarian disorders (9). Uterine infection can be caused by environmental conditions during delivery, but the retained placenta is the most important predisposition (20). Escherichia coli contamination can also be the result of an unfavorable environment, especially postpartum. An unfavorable postpartum environment will facilitate the entry of microbes into the uterine lumen, pollute the uterine lumen environment, and interfere with embryonic life which can cause early embryonic death.
The presence of E. coli that encodes the antibiotic resistance gene of Bali cattle from the reproductive tract indicates that the uncontrolled use of antibiotics has caused E. coli to produce antibiotic resistance genes. Uncontrolled administration of antibiotics will cause the response of bacteria to become resistant by various mechanisms including enzyme production and mutation. Mutations in the gene of E. coli can occur through point mutations and rearrangement of DNA segments. Allcock et al. (21) stated that a bacterium will become resistant to an antibiotic may have one or more mechanisms. Genetic variation is critical to microbial evolution and may arise by a variety of mechanisms including point mutations, rearrangement of large segments of DNA from one chromosomal or plasmid location to another, or acquisition of foreign DNA from another bacterium by horizontal transfer of cells' genetic elements.
E. coli that are resistant to antibiotics from the bovine reproductive tract will be able to transfer resistant genes to other bacteria in the bovine reproductive tract. The E. coli can also transfer its resistance gene to other bacteria when it is released from the reproductive tract into the environment by horizontal gene transfer. Horizontal gene transfer of E. coli, which encodes the resistance gene that occurs, will cause a wider spread of antibiotic-resistant genes by exchanging their genetic material to other bacteria in other animals, humans, and the environment. Escherichia coli which carries the material for the resistance gene may be able to transfer the gene to humans and other animals. Le Roux and Blokesch (22) stated that horizontal gene transfer (HGT) allows bacteria to exchange their genetic material including antibiotic-resistance genes among diverse species. Antibiotic resistance genes are found in various species.
Conclusion
Escherichia coli from the reproductive tract of Bali cattle showed the character of Escherichia coli S2.2-EK pEC-S2.2 blaTEM gene for class A broad-spectrum β-lactamase TEM-206 with a high degree of kinship and has developed multidrug resistance to antibiotics.
Acknowledgment
The author is grateful to the Faculty of Veterinary Medicine, Airlangga University, Universitas Pendidikan Mandalika, the Institute of Biosciences and the Faculty of Veterinary Medicine, Universitas Brawijaya, and to the Health Laboratory of Testing and Calibration of West Nusa Tenggara Province for collaborating in sampling and testing that have permitted and facilitated this research.
Conflict of interest
There is no conflict of interest.