Introduction
Entamoeba histolytica, a protozoan, is the source of the illness known as amoebiasis, sometimes known as amoebic dysentery. The majority of cases are asymptomatic, but extensive intestinal illness can develop and cause weight loss, cramps, stomach discomfort, and diarrhea (could be bloody) that lasts for many weeks. Diffused extraintestinal illness is reported to cause purulent pericarditis, liver abscess, pneumonia, and even brain amoebiasis (1). E. histolytica is thought to affect up to 50 million people globally, mostly in underdeveloped nations, and it is the cause of over 100,000 fatalities each year. The most common methods of transmission are through the consumption of contaminated food or water brought on by the fecal expulsion of cysts, as well as fecal-oral transmission and due to homosextuality, a man having sex with another man (2-11). Amoebiasis is a disease that affects people everywhere, especially in countries with poor sanitary systems. Infection is rising in wealthier nations like those in North America as a result of an upsurge in emigration and travel from highly disease-prevalent countries (1,12). India, Africa, Central and South America, especially Mexico, have the greatest infection rates. Males and females almost equally contract amoebic colitis at the same rate. Males are ten times more likely to develop an amoebic liver abscess (ALA) than females, and those between the ages of 18 and 50 are most frequently affected (13). E. histolytica is an invasive intestinal protozoan. When mature quadrinucleated cysts are ingested in food or drink contaminated with fecal materials, an infection usually starts. Motile trophozoites are released after excystation in the small intestine to the large intestine (14). Both trophozoites and cysts are produced by binary fission, and both are excreted in feces, but only cysts have the capacity to transmit infection because of their hard wall. While trophozoites are quickly killed when they leave the body or by stomach secretions if consumed, cysts can persist days to weeks in such environments. Trophozoites are able to attach to and destroy the colonic epithelium before blood-stream, spreading to far-off locations including the peritoneum, liver, lung, or brain via the portal vein system (15-17).
This study is carried out to evaluate the occurrence of Entamoeba histolytica in cattle in Al-Diwaniyah Governorate, Iraq.
Materials and methods
Samples
Fifty fecal samples were collected from cattle in different areas of Al-Diwaniyah Governorate, Iraq. The samples, which were collected in May-October, 2022, were capped in containers that were cold-transported to the Parasitology Laboratory, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah Governorate, Iraq.
PCR and DNA Sequencing
Each fecal sample (200 mg) was washed in 1ml-sterile Phosphate Buffer saline pH 7.2, 5mins-14,000 × g-centrifuged, according to the instructions of QIAGEN kit (QIAGEN, Hilden, Germany), then, DNA was extracted. The primers employed in the current study were F: TGGACTTCAGGGGGAGTATG and R: TCAATCTCGGTACACCACTCA for a product of 545bp (18). DNA polymerase at 0.2µl 5U/µl, DNA at 2µl 100ng, each primer at 0.6µl 40µM, and 16.5µl PCR-water were used for the PCR reaction component. At the conditions, 94°C-Denaturation, 40 cycles of (92°C-60s denaturation, 47°C-60s annealing, and 72°C-90s-extension), and 72°C-7mins final extension were employed for the thermocycler. The PCR products were purified and sent to Macrogen (Korea) to perform partial gene sequencing. The phylogenetic tree was generated using MEGA X, and similar world sequences were detected using NCBI websites.
Results
The outcomes of the microscopy demonstrated the presence of the parasitic cyst and trophozoite in 66% (33/50) of the fecal samples from the tested cattle (Figure 1). The results of the PCR showed that the genus level of Entamoeba was positive in 72%, (36/50) of fecal samples (Figure 2). The sequencing reported the existence of four closely similar isolates to isolates registered in Baghdad City, Iraq, (MW426065 and MW426066) (Figure 3).
Figure 1: (A) Trophozoite and (B) cyst of Entamoeba histolytica identified from fecal samples of cattle. (X100)
Figure 2: Image of SSU rRNA gene-based agarose gel electrophoresis of Entamoeba histolytica identified from fecal samples of cattle. M: Ladder. Lanes 1-7: bands of positive detection.
Figure 3: Phylogenetic tree of SSU rRNA gene of Entamoeba histolytica identified from fecal samples of cattle. Colored labels: Isolates of the current study.
Discussion
Entamoeba histolytica is commonly known as highly infectious parasite that causes a severe diarrheal disease in humans; however, some reports noted that this protozoan could cause a disease in animals (19). The current study demonstrated, via the use of microscopy, the species identification of the parasite; however, it is said that microscopy can often be employed to diagnose protozoa in stool samples, but to the genus level. In disagreement with the current result, researchers suggested that this approach is unable to distinguish E. histolytica from other non-pathogenic species like E. dispar, which has physical similarities with it (20). As a result, the WHO urged the creation and use of novel techniques for a precise diagnosis of E. histolytica infections (20), including the PCR, which can be a better choice for the significant detection of the protozoan.
The results of the current study ensured that the PCR is highly effective in the detection of E. histolytica. Hence, utilizing PCR is another option for separating the species. Compared to microscopy, this method has high sensitivity and specificity. A study by López-López et al. (20) used a piece of the adh112 gene to identify and to differentiate between E. histolytica and E. dispar. They found that this gene showed five variations in single nucleotide between the two species. E. histolytica and E. dispar were successfully detected using a variety of techniques, and real-time PCR. Unfortunately, the expensive price restricts their application in developing countries, and some of them also, provides falsely negative findings (21-37). Moreover, the SSu rRNA gene based PCR was highly effective in the current detection, and this agrees with López-López et al. (20).
According to the results of the microscopic study and PCR tests by Aryal et al. (38), it was revealed that 80% of the wild water buffaloes had E. bovis infection. Also, a research conducted in China showed that E. bovis infection affected 100% of cattle and more than 90% of yak and some small ruminants (39). In a Ugandan investigation, E. bovis infection was detected in 60% of goats and 80% of cattle (40).
Conclusion
The study suggested that Entamoeba histolytica is currently present in the cattle tested in Al- Diwaniyah Governorate, and that zoonotic infection could strongly be induced in people in contact with animals testing positive.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady, Dean of College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, agency of financing, or elsewhere to conduct this study.
|
- Kantor M, Abrantes A, Estevez A, Schiller A, Torrent J, Gascon J, Hernandez R, Ochner C. Entamoeba Histolytica: Updates in clinical manifestation, pathogenesis, and vaccine development. Can J Gastroenterol Hepatol. 2018;(12):4601420-5. DOI: 1155/2018/4601420
- Alfatlawi MA, Ismail YK, Ali MJ, Karawan AC, Ibadi IN. Molecular differentiation of Thysaniezia (Helictometra) giardi and Moniezia species based on 18s rRNA gene in small ruminants. Iraqi J Vet Sci. 2021;35(1):105-108. DOI: 33899/ijvs.2020.126407.1313
- Ali MJ, Karawan AC, Al-Fetly DR, ALfatlawi MA. Synergizing the deltamethrin larvicidal activity against Aedes albopictus larvae using cinnamaldehyde in Diwaniyah, Iraq. Iraqi J Vet Sci. 2020;34(2):317-320. DOI: 33899/ijvs.2019.126026.1212
- Escolà-Vergé L, Arando M, Vall M, Rovira R, Espasa M, Sulleiro E, Armengol P, Zarzuela F, Barberá MJ. Outbreak of intestinal amoebiasis among men who have sex with men, Barcelona (Spain), October 2016 and January 2017. Euro Surveill. 2017;22(30):30581-4. DOI: 2807/1560-7917.ES.2017.22.30.30581
- El-Khabaz KS, Abdel-Hakeem SS, Arfa MI. Protozoan and Helminthes parasites endorsed by imported camels (Camel dromedaries) to Egypt. J Parasit Dis. 2019;43(4):607-615. DOI: 1007/s12639-019-01138-y
- Alfatlawi MA, Jasim AA, Jarad NE, Khlaif SF. Clinical and molecular identification of ruling Theileria annulata strains in cattle calves in Al-Diwaniyah province, Iraq. Iraqi J Vet Sci. 2021;35(1):115-119. DOI: 33899/ijvs.2020.126429.1319
- Aydın N, Vatansever Z, Arslan MÖ. Molecular epidemiology of babesia and theileria species in sheep in Kars region of Turkey. Turkiye parazitolojii Derg. 2022;46(1):20-7. DOI: 4274/tpd.galenos.2021.09709
- Sazmand A, Joachim A. Parasitic diseases of camels in Iran (1931-2017) - a literature review. Parasite. 2017;24(6):21-35. DOI: 1051/parasite/2017024
- Omer SA, Alsuwaid DF, Mohammed OB. Molecular characterization of ticks and tick-borne piroplasms from cattle and camel in Hofuf, eastern Saudi Arabia. Saudi J Biol Sci. 2021;28(3):2023-8. DOI: 1016/j.sjbs.2021.01.005
- Alvarado-Esquivel C, Sanchez-Anguiano LF, Hernandez-Tinoco J, Estrada-Martinez S, Perez-Alamos AR, Ramos-Nevarez A, Soto SI, Guido-Arreola CA. Entamoeba histolytica infection in female sex workers: A matched case-control study in Durango, Mexico. J Clin Med Res. 2017;9(7):624-9. DOI: 14740/jocmr3065w
- Cheepsattayakorn A, Cheepsattayakorn R. Parasitic pneumonia and lung involvement. Biomed Res Int. 2014(6):874021-38. DOI: 1155/2014/874021
- Singh A, Banerjee T, Khan U, Shukla SK. Epidemiology of clinically relevant Entamoeba spp. ( histolytica/dispar/moshkovskii/bangladeshi): A cross sectional study from north India. PLoS Negl Trop Dis. 2021;15(9):e0009762-73. DOI: 10.1371/journal.pntd.0009762
- Bernin H, Marggraff C, Jacobs T, Brattig N, Van An L, Blessmann J, Lotter H. Immune markers characteristic for asymptomatically infected and diseased Entamoeba histolytica individuals and their relation to sex. BMC Infect Dis. 2014;14(1):621-30. DOI: 1186/s12879-014-0621-1
- Naiyer S, Bhattacharya A, Bhattacharya S. Advances in Entamoeba histolytica biology through transcriptomic analysis. Front Microbiol. 2019;10(8):1921-32. DOI: 3389/fmicb.2019.01921
- El-Naga TR, Barghash SM. Blood parasites in camels (Camelus dromedarius) in northern west coast of Egypt. J Bacteriol Parasitol. 2016;7(1):1-8. DOI: 4172/2155-9597.1000258
- Sharifah N, Heo CC, Ehlers J, Houssaini J, Tappe D. Ticks and tick-borne pathogens in animals and humans in the island nations of southeast Asia: A review. Acta Trop. 2020;209(9):1055229. DOI: 1016/j.actatropica.2020.105527
- Wuerz T, Kane JB, Boggild AK, Krajden S, Keystone JS, Fuksa M, Kain KC, Warren R, Kempston J, Anderson J. A review of amoebic liver abscess for clinicians in a nonendemic setting. Can J Gastroenterol. 2012;26(10):729-33. DOI: 1155/2012/852835
- Gunther J, Shafir S, Bristow B, Sorvillo F. Amebiasis-related mortality among United States residents, 1990-2007. Am J Trop Med Hyg. 2011;85(6):1038-40. DOI: 4269/ajtmh.2011.11-0288
- Alfatlawi MA, Alfatlawy HH. COX1 gene and ITS-2 region: A comparative study of molecular diagnosis of Parabronema skrjabini in camels (Camelus dromedaries), Al-Najaf province, Iraq. Iraqi J Vet Sci. 2022;36(1):77-84. DOI: 33899/ijvs.2021.129228.16341
- López-López P, Martínez-López MC, Boldo-León XM, Hernández-Díaz Y, González-Castro TB, Tovilla-Zárate CA, Luna-Arias JP. Detection and differentiation of Entamoeba histolytica and Entamoeba dispar in clinical samples through PCR-denaturing gradient gel electrophoresis. Braz J Med Biol Res. 2017;50(4):e5997-6103. DOI: 1590/1414-431x20175997
- Calderaro A, Piergianni M, Buttrini M, Montecchini S, Piccolo G, Gorrini C, Rossi S, Chezzi C, Arcangeletti MC, Medici MC, De Conto F. MALDI-TOF mass spectrometry for the detection and differentiation of Entamoeba histolytica and Entamoeba dispar. PLoS One. 2015;10(4):e0122448-64. DOI: 1371/journal.pone.0122448
- Spadafora LJ, Kearney MR, Siddique A, Ali IK, Gilchrist CA, Arju T, Hoffstrom B, Nguyen FK, Petri WA, Haque R, Haque R. Species-specific immunodetection of an Entamoeba histolytica cyst wall protein. PLoS Negl Trop Dis. 2016;10(5):e0004697-711. DOI: 1371/journal.pntd.0004697
- Chávez-Munguía B, Martínez-Palomo A. High-resolution electron microscopical study of cyst walls of Entamoeba spp. J Eukaryot Microbiol. 2011;58(6):480-6. DOI: 1111/j.1550-7408.2011.00576.x
- Youssef SY, Yasien S, Mousa WA, Nasr SM, El-Kelesh EM, Mahran KM, Abd-El-Rahman AH. Vector identification and clinical, hematological, biochemical, and parasitological characteristics of camel (Camelus dromedarius) theileriosis in Egypt. Trop Anim Health Prod. 2015;47(4):649-56. DOI: 1007/s11250-015-0771-1
- Qablan MA, Sloboda M, Jirků M, Oborník M, Dwairi S, Amr ZS, Horin P, Lukeš J, Modry D. Quest for the piroplasms in camels: Identification of Theileria equi and Babesia caballi in Jordanian dromedaries by PCR. Vet Parasitol. 2012;186(3-4):456-60. DOI: 1016/j.vetpar.2011.11.070
- Naser HH. The genotype of Entamoeba histolytica in bloody diarrhea samples of humans, cows and sheep. Iraqi J Vet Sci. 2020;34(2):453-458. DOI: 33899/ijvs.2020.126135.1242
- Matjila PT, Leisewitz AL, Oosthuizen MC, Jongejan F, Penzhorn BL. Detection of a theileria species in dogs in south Africa. Vet Parasitol. 2008;157(1-2):34-40. DOI: 1016/j.vetpar.2008.06.025
- Abdlla YA, Al-Sanjary R. The molecular identification of diarrheagenic Escherichia coli (DEC) isolated from meat and meat products. Iraqi J Vet Sci. 2023;37(1):9-15. DOI: 33899/ijvs.2022.133244.2192
- Abdelmonem GI, Amer AM, Hussein EA, Aboezz ZR, Habashi AR, Sharawi SS. Assessment of multiplex PCR for detection of FMDV, BVDV, BTV, and possible coinfection with Pasteurella multocida in cattle. Iraqi J Vet Sci. 2022;36(4):1053-1059. DOI: 33899/ijvs.2022.132983.2158
- Al-Baroodi SY. Seroprevelance of schmallenberg virus infection as emerging disease in cattle in Iraq. Iraqi J Vet Sci. 2021;35(3):495-499. DOI: 33899/ijvs.2020.127071.1454
- Abdulrazzaq KM, Owain MS, Majeed HM, Al-Hyani OHH. Molecular detection of rfbO157, shiga toxins and hemolysin genes for Escherichia coli O157: H7 from canine feces in Tikrit and Mosul cities, Iraq. Iraqi J Vet Sci. 2021;35(2):325-329. DOI: 33899/ijvs.2020.126831.1392
- Alfatlawi MA, Jasim AA, Jarad NE, Khlaif SF. Clinical and molecular identification of ruling Theileria annulata strains in cattle calves in Al-Diwaniyah province, Iraq. Iraqi J Vet Sci. 2021;35(2):115-119. DOI: 33899/ijvs.2020.126429.1319
- Majeed NM, Aaiz NN, Neama AJ. Molecular study to detect the Eimeria species in sheep in Al-Diwaniyah province, Iraq. Iraqi J Vet Sci. 2021;35(2):377-381. DOI: 33899/ijvs.2019.126064.1225
- Sabri JB, Al-Sultan II, Altaif K, Peter S, Saadh MJ. Pathogenesis of Salmonella entericaserovar albany in experimental infected SPF BALB/c Mice. Iraqi J Vet Sci. 2021;35(2):339-344. DOI: 33899/ijvs.2019.126269.1282
- AL-Baroodi SY, Kurdi A, Alomar A. Isolation of bovine herpes virus type-1 (BHV-1) from cattle in Syria. Iraqi J Vet Sci. 2021;35(2):309-320. DOI: 33899/ijvs.2012.168753
- Ibrahim FS, Gad M, Ashour A, Soliman M, El-Senousy M, Al-Herrawy A. Molecular detection of Entamoeba histolytica in fresh vegetables and irrigation. Egypt J Aquat Biol Fish. 2019;22(5):551-561. DOI: 21608/ejabf.2019.24756
- Broucke SD, Verschueren J, Esbroeck MV, Bottieau E, Ende JD. Clinical and microscopic predictors of Entamoeba histolytica intestinal infection in travelers and migrants diagnosed with Entamoeba histolytica/dispar infection. PLoS Negl Trop Dis. 2018;12(10):20006892. DOI: 1371/journal.pntd.0006892
- Aryal M, Adhikari RB, Kandel P, Ghimire TR, Khadka D, Maharjan J, Gaire KP, Shrestha S, Manandhar KD, Kandel RC, Poudel RC, Pandey K. First report on the molecular detection of Entamoeba bovis from the endangered wild water buffalo (Bubalus arnee) in Nepal. Vet Med Sci. 2022;8(2):799-807. DOI: 1002/vms3.697
- Ren M, Yang F, Gou JM, Wang PX, Zou M, Zhong XH, Lin Q. First detection and molecular identification of entamoeba in Yaks from China. Acta Parasitol. 2021;66(1):264-70. DOI: 1007/s11686-020-00258-3
- Nolan MJ, Unger M, Yeap YT, Rogers E, Millet I, Harman K, Fox MT, Kalema-Zikusoka G, Kalema-Zikusoka G. Molecular characterisation of protist parasites in human-habituated mountain gorillas (Gorilla beringei beringei), humans and livestock, from Bwindi impenetrable national park, Uganda. Parasite Vectors. 2017;10(1):340-51. DOI: 1186/s13071-017-2283-5
|