Introduction
As one of the Parasites of food-borne illnesses, Sarcocystis are intracellular protozoa. Until recently, 196 genuine species of Sarcocystis have been identified, and each of them is very selective regarding the types of hosts it can live on. Cysts are produced by parasites and may be seen in the striated muscles and the brains of pigs, cattle, and sheep (1-5). Eating raw or undercooked meat carrying sarcocystosis may spread infections of S. hominis, S. heydorni, and S. suihominis. Both S. hominis and S. suihominis have been designated as zoonotic risks by the European Food Safety Authority (6-12). Sheep may be infected with Sarcocystosis through drinking contaminated water or eating wild feed containing the parasite's sporocysts, leading to weight loss, abortion, early delivery, and even death (13-16). Most species of Sarcocystis need not one but two different hosts during their life cycles, with carnivores serving as the final hosts and herbivores acting as intermediate hosts. Only four parasitic species have been confirmed to infect sheep: the non-pathogenic parasitic species (macroscopic) S. gigantea and S. medusiformis transferred by felids, and the pathogenic parasitic species (microscopic) S. tenella and S. arieticanis spread by canids (17-21). Sarcocystis spp. Infects various animals, especially mammals, birds, and fish. The final host is responsible for the sexual phases of gametogony and sporogony. In contrast, the intermediate host is responsible for the asexual phases of merogony and cyst development (22,23). Sarcocystis infections in intermediate hosts are often asymptomatic, but severe instances have been observed, resulting in the host's fatigue, loss of appetite, diarrhea, loss of weight, muscular twitching, and in very exceptional instances, mortality. Muscle tissue cysts carrying bradyzoites are a characteristic feature of the degenerative alteration known as sarcocystosis, which occurs in the intermediate host. Infections by Sarcocystis ovicanis or Sarcocystis neurona has been linked to rare cases of encephalitis in sheep and horses (24,25).
The presented investigation was performed to identify Sarcocystis species, in an intermediate-host parasite with zoonotic importance, infection in slaughtered sheep identified by traditional, histopathological, and molecular methods in Al-Diwaniyah Province, Iraq.
Materials and methods
Samples
The presented work collected 70 intercostal and esophageal muscle samples (10-40gm/each) from slaughtered sheep from April-December, 2022. The samples were cooled-box-transported to the Laboratory of Parasitology, College of Veterinary Medicine, University of Al-Qadisiya, Al-Diwaniyah City, Iraq.
Microscopic examination
The samples were examined for Sarcocystic bradyzoites and cysts using squeezing, trichoscopy, and solution analysis methods described by Al-Bayatee (26) and Al-Dulaimi (27).
18S rRNA gene-based PCR
18S rRNA gene-based PCR was performed using primers, Sar-F1: GCACTTGATGAATTCTGGCA and Sar-R1: CACCACCCATAGAATCAAG, followed by Stecher et al. (13). The QIAamp DNA Mini Kit (Qiagen, Germany), with steps from the kit itself was employed for the bradyzoite DNA extraction. A 1.5% agarose gel was placed under an electrophoresis process for 60mins at 100 volts and 80Amp. The gel, after that, was visualized under a UV-based imager. Stecher et al. (28) employed the methods in the current section.
18S rRNA-PCR product-based sequencing
The PCR-product-dependent gene sequencing method sends the PCR-purified products to Macrogen (Korea) for sequencing. The sequences were processed using MEGA X software and NCBI websites to complete the analyses and build a phylogenic tree.
Results
Microscopic test
The results of the microscopic method revealed that 65 (93%) of the muscle samples contained bradyzoites (Figure 1).
Figure 1: The bradyzoites of Sarcocystis spp. in sheep muscle tissue, 40X.
Histopathological findings
The pathohistological picture showed the presence of two microsarcocysts with different morphological thin or thick wall sizes (Figure 2).
Figure 2: Encysted parasite in skeletal muscle showing internal bradyzoite nuclei separated by clear internal septations. H and E stain ×100.
18S rRNA gene-based PCR findings
The PCR demonstrated that 68/70 (97%) of the samples were positive for the occurrence of the parasite DNA (Figure 3).
Figure 3: Image of agarose gel electrophoresis. It shows the 18S rRNA gene-based piece amplification of Sarcocystis spp. of sheep. 1-16: Positive samples. C: Negative control (No DNA). M: Molecular marker.
Findings of 18S rRNA-PCR product-based sequencing
According to the NCBI-based websites, the Phylogenetic analysis revealed that the isolates from the current study were closely similar in their nucleotide sequences with isolates from Norway, Egypt, and Iran (Table 1 and Figure 4).
Table 1: Homology sequence identity (%) in local Sarcocystis sp in sheep
|
Obtained Accession number
|
Identical to
|
GenBank Accession number
|
Country
|
Identity (%)
|
Host
|
| OP835896 |
Sarcocystis tenella |
MT560372
|
Iran
|
99.38 |
sheep |
| OP835897 |
Sarcocystis tenella |
MT569891
|
Iran |
100 |
sheep |
| OP835898 |
Sarcocystis tenella |
MK420019
|
Norway
|
99.80 |
sheep |
| OP835899 |
Sarcocystis tenella |
MG515221
|
Egypt
|
99.59 |
sheep |
| OP835900 |
Sarcocystis tenella |
MT569891
|
Iran
|
100 |
sheep |
| OP835901 |
Sarcocystis tenella |
MT569891
|
Iran
|
100 |
sheep |
| OP835902 |
Sarcocystis tenella |
MT569891
|
Iran
|
100 |
sheep |
| OP835903 |
Sarcocystis tenella |
MT569891
|
Iran
|
100 |
sheep |
| OP835904 |
Sarcocystis tenella |
MT569891
|
Iran
|
99.59 |
sheep |
| OP835905 |
Sarcocystis tenella |
MT569891
|
Iran
|
100 |
sheep |
Figure 4: Phylogenetic tree of Sarcocystis spp in sheep based on the 18S rRNA gene.
Discussion
Similar to the earlier findings from Baghdad 91.93% (26). this research found a prevalence of Sarcocystis infection in sheep of 93%. And in Mongolia, the sheep have an infection rate of 97%, a 100% in Iran's sheep population, and 84 % in American sheep (29). Molecular methods, such as PCR amplification of species-specific 18s rRNA, are necessary for identifying species in this genus, which cannot be done only by microscopy. These results, at 97%, show that molecular diagnosis for sarcocystosis has a greater infection rate than traditional methods. Likewise, 90.78 % of the sheep samples in Karbala Province (30), Iraq, were infected with the parasite (31-33).
The Sartcocystis includes Sarcosporidia, known for their versatility in where they invade and grow inside the intermediate host. In addition, investigational transfer of the muscle cysts from sheep to dog puppies revealed the coccidian character of Sarcocystis, where the parasite was found at a higher incidence (34). Sarcocysts, only seen in the muscular parts of intermediate hosts, were characterized as evidence of a wide variety of host species and global dissemination. The current research demonstrated that natural infection rates in the tested hosts' skeletal muscles and organs varied. These findings are consistent with those found previously in Riyadh (35-37).
Alternatively, other nations reported lower levels. This research demonstrated a very varied rate of Sarcoystis distribution throughout several sheep organs. Oocyst exposure, changes in host immunity owing to abnormalities in the environmental and nutritional state, and parasite speciation are all possible causes for the observed variances in intensity among the tested hosts, as revealed by different studies (38). Other reports of detecting Sarcocystis spp. in different countries, such as Saudi Arabia, Tunisia, and China (39-41).
Conclusion
The present data indicate high infection levels by Sarcocystis spp. in slaughtered sheep, which could bring alarm for public health importance.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady, Dean of the College of Veterinary Medicine, University of Al-Qadisiya, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, financing agency, or elsewhere to conduct this study.