Introduction
Sarcocystis is one of the most common parasites affecting animals and humans (1,2). Sarcocystis is a ubiquitous parasite of many different animals; some species are specific to the intermediate host, while others have a more comprehensive range of hosts (3,4). Currently, 225 species of Sarcocystis have been identified and recognized. Goats are exposed to many viral, bacterial, and parasitic diseases, including genus Sarcocystis, which lead to significant losses (5,6). Within the species, Apicomplexa, protozoan parasites of the genus Sarcocystis have an obligatory two-host life cycle that requires two separate hosts in a prey-predator relationship: a definitive host (in which the sexual stage develops by producing oocysts/sporocysts in the intestine mucosa of carnivores predator when, after eating mature sarcocysts in animal muscles (meat), they become infected with bradyzoites that develop in the gastrointestinal tract, and an intermediate host, they reproduce asexually forming sarcocysts in the vascular endothelial and striated muscle cells of herbivores prey and omnivores when, after ingesting sporocysts in food or water contaminated with animal feces; humans can serve as both intermediate and definitive hosts with several Sarcocystis species (7). Three tissue cyst-forming Sarcocystis species were described in domestic goats; these include S. capracanis, S. hircicanis, and S. moulie (S. caprafelis) (8). Since the appearance of Sarcocystis, many changes depending on the locations and stages of development of sarcocysts and other conditions of the parasitized cell and molecular studies have been suggested to confirm species identification (9,10). The evidence of new molecular techniques has provided new diagnostic means for parasitic infections; PCR reaction has been developed recently to differentiate Sarcocystis organisms genetically. Sequencing was performed on DNA product obtained from PCR reaction for extra species differentiation of Sarcocystis, while the importance of worldwide goat production, which is little known about the prevalence of Sarcocystis spp. in domestic goats (Capra hircus) (11-13). This study aims to detect and make a molecular diagnosis of Sarcocustis spp. in goats in Wasit province, Iraq.
Materials and methods
Samples collection
The samples of 100 from (the esophagus and diaphragm) were collected from different ages of 100 slaughtered goats (Capra hircus) examined in Wasit Province from October 2019 to the end of March 2020. Then, the samples were transported in refrigerator bags to the parasitology laboratory in the College of Veterinary Medicine-University of Baghdad.
Detection of macroscopic cysts
The naked eyes detected macroscopic sarcocysts in the samples (esophagus and diaphragm). These samples were divided into two parts: the first was kept for the laboratory tests (trichinoscopy, squeezing, and acid pepsin digestion), and the second was held in deep freeze under -20 ºC for DNA extraction.
Trichinoscopy
A small piece of meat specimens (esophagus and diaphragm) in the size of a pinhead approximately 3-5 mm thick were by use of these small pieces of meat specimens was crushed firmly between two glass slides and examined under the microscope at (X10) magnification for diagnosis of the microscopic cyst of the parasite (14).
Squeezing
By using the garlic press (3-5) grams from each sample were put; then, these samples were ripped by a sterile scissor. After that, the pieces were placed in the presser, and a slight drop of meat juice was transferred to the slide, then stained with Giemsa stain and examined under a microscope (X 40) to observe the presence of bradyzoites (15).
Measurement of Sarcocystis cyst by ocular micrometer
The ocular eyepiece was replaced with one containing an ocular micrometer, then examined under X10 magnification to determine and measure cysts in both the esophagus and diaphragm (3).
Tissue DNA extraction
Genomic DNA from the esophagus and diaphragm muscle samples were extracted using gSYAN DNA mini kit extraction kit (tissue protocol) Geneaid, United States, and done according to company instructions.
Genomic DNA concentration and purity
The extracted genomic DNA was checked by using a Nanodrop spectrophotometer (THERMO. United States), which measured DNA concentration (ng/µL) and checked the DNA purity by reading the absorbance at (260 /280 nm).
Polymerase chain reaction (PCR)
PCR technique was performed for the detection of Sarcocystis spp. based on amplifying internal transcribed spacer one ribosomal RNA gene (ITS1) from the esophagus and diaphragm muscles goat samples.
Primers
The PCR primers were used to amplify a fragment of the internal transcribed spacer one ribosomal RNA (ITS1) gene to detect Sarcocystis spp. parasite designed in this study by using NCBI Genbank and primer three plus and create an online program; these primers were provided by (Scientific Researcher. Co. Ltd. Iraq) (Table 1).
Table 1: Primers design for this study
|
Primer
|
Sequence (5’-3’)
|
Size
|
|
ITS1
|
F ACCGGCTGAACTTAAGCACA
R GGGACCTACCTTTTGCACCA
|
608 bp
|
PCR master mix preparation
PCR master mix was prepared using (the AccuPower PCR PreMix Kit), and this master mix was done according to the company prescript (Table 2).
Table 2: PCR master mix preparation
|
PCR Master mix
|
Volume
|
|
DNA template
|
5µl
|
|
ITS1-rRNA gene forward primer (10pmol)
|
1µl
|
|
ITS1-rRNA gene reveres primer (10pmol)
|
1µl
|
|
Molecular grade water
|
13µl
|
|
Total volume
|
20µl
|
After that, these PCR master mix components mentioned above were placed in a standard PCR mix AccuPower PCR PreMix kit that contained all other elements needed for PCR reaction such as (Taq DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, MgCl2, stabilizer, and tracking dye). Then, all the PCR tubes were transferred into an Exispin vortex centrifuge at 3000rpm for 3 minutes and then placed in a PCR Thermocycler (T100 Thermal cycler BioRad. the United States).
PCR thermocycler conditions
PCR thermocycler conditions were done by using a conventional PCR thermocycler system (Table 3).
Table 3: PCR thermocycler conditions
|
PCR steps
|
Temp.
|
Time
|
Cycle
|
|
Initial Denaturation
|
95◦C
|
5 min.
|
1
|
|
Denaturation
|
95◦C
|
30 sec.
|
32
|
|
Annealing
|
58◦C
|
30 sec.
|
|
Extension
|
72◦C
|
1 min.
|
|
Final extension
|
72◦C
|
5 min.
|
1
|
|
Hold
|
4◦C
|
Forever
|
-
|
DNA sequencing method
Ten positive samples from goats by PCR technique were subjected to sequencing to detect Sarcocystis spp. These PCR ITS-1 gene-positive products were sent by ice bag by DHL to Macrogen Company in Korea to perform the DNA sequencing by AB DNA sequencing system. The genetic analysis was done by phylogenetic tree analysis between local Sarcocystis species isolates and NCBI-Blast submission Sarcocystis species. Then, the identification species isolates were submitted to NCBI-GenBank.The DNA sequencing analysis by utilizing Molecular Evolutionary Genetics Analysis version 6.0. (Mega 6.0) and Multiple sequence alignment analysis of the partial small subunit ribosomal rRNA gene depends on an analysis of ClustalW alignment analysis. The development distances were computed by the Maximum Composite Likelihood method by phylogenetic tree UPGMA method.
Results
Macroscopic examination
The results of the macroscopic examination in the diaphragm showed oval or cylindrical macrocysts similar to milky white rice grain size (Figure 1).
Figure 1: Goats diaphragm muscle, with white oval thin and thick cyst (sarcocysts).
Microscopic examination
Using the microscopic trichoscopy technique, different shapes of sarcocysts were revealed, such as elliptical and ovoid forms in the esophagus (Figure 2) which are divided into compartments with dissimilar measurements. The dimensions were recorded in the esophagus 121.2-28.1×17.2-3.6 μm with different measurement ranges 71.6*9.5 μm and in the diaphragm 111.8-34.76*15.42-4.9 at rang 65.5*9.2 μm.
Figure 2: The microcyst of Sarcocystis spp. by trichinoscopy showed esophagus cyst septa dividing the internal compartments as dark structures (X 10).
Characterization of bradyzoite
Morphologically, unstained bradyzoites appeared brownish and clear under a light microscope, whereas bradyzoites stained dark blue with Giemsa stain. Bradyzoites (Cystizoites) appeared in different morphological characteristics and sizes; they have a banana shape with a little pointed anterior end and rounded posterior end with no apparent nucleus, usually near the last third part close to the posterior (Figure 3).
Figure 3: The bradyzoites (cystizoite) of goats Sarcocystis spp. A: After exploding the microcyst, 40x. B: stained with Giemsa stain, 100x.
Molecular detection of Sarcocystis spp. by using conventional polymerase chain reaction technique
The PCR technique was detected using an internal transcribed spacer with one ribosomal RNA gene (ITS1) amplified to diagnose Sarcocystis spp. After PCR, it was analyzed by an agarose gel electrophoresis 1.5% stained by ethidium bromide stain using the voltage at 100 volts and 80 AM for 1 hour. The positive DNA bands were 608 bp (Figures 4 and 5).
Figure 4: Agarose gel electrophoresis image of the PCR product analysis of ITS1 gene in Sarcocystis spp. from esophagus tissue of goat samples. Where M: marker (100-2000bp); lane 1= negative control and lanes = (2, 19) shows negative Sarcocystis spp. and lanes = (3-18, 20, 21) shows positive Sarcocystis spp. at 608bp PCR product.
Figure 5: Agarose gel electrophoresis image of the PCR product analysis of ITS-1 gene in Sarcocystis spp. from diaphragm tissue of goat samples. Where M: marker (100-2000bp); lane 1= negative control and lanes = (3, 19) shows negative Sarcocystis spp. and lane = (2, 4-18) shows positive Sarcocystis spp. at (608bp) PCR product.
Total infection rate of Sarcocystis spp. in goats according to PCR
According to conventional PCR analysis, the total infection rates of goats' DNA samples showed 89 (89%) positive that of 100 examined tissue samples collected from goats in Wasit province (Table 4).
Table 4: Total infection rate of Sarcocystis spp. in goats according to polymerase chain reaction
|
Host
|
Examined No.
|
Infected No.
|
Percentage %
|
|
Goats
|
100
|
89
|
89
|
Sequencing analysis
Ten samples of PCR products out of 89 positive PCR samples were collected and sequenced using forward and reverse primers. The sequences were manipulated in gene bank database NCBI accession numbers: sample No.1 (MW052223), No.2 (MW052224), No.3 (MW052225), No.4 (MW052226), No.5 (MW052227), No.6 (MW052228), No.7 (MW052229), No.8 (MW052230), No.9 (MW052231), No.10 (MW052232) (as in Appendix). These sequences were blasted at the NCBI-BLAST program to present highly similar sequences found in NCBI. Sequences accentuation using references of ITS-1 gene of Sarcocystis parasite confirmed that four out of ten Iraqi Sarcocystis species goats isolates (MW052225, MW052226, MW052231, and MW052232) were closely related to S. hircicanis (KU820984.1) isolates, with identity score as ( 99.83 - 99.65 and 99.48% ), while another three samples of Sarcocystis goats isolates (MW052224, MW052227, MW052230) were closely related to S. capracanis (MT772238.1) isolates, with identity score as (99.32 -99.66%), furthermore, three sample of Sarcocystis goats isolates (MW052223, MW052228, MW052229) was closely related to NCBI-BLAST S. gigantea, (L24384.1) with identity score (94.62 - 99.66 %) (Table 5).
Table 5: The NCBI-BLAST homology sequence identity between Iraqi Sarcocystis spp. goats isolates and NCBI-BLAST isolates
|
Sarcocystis spp. local goats isolate No.
|
Accession number
|
NCBI-BLAST Homology Sequence identity (%)
|
|
Identical Sarcocystis spp.
|
Accession number
|
Country
|
Identity (%)
|
|
No.1
|
MW052223
|
S. gigantea
|
L24384.1
|
Australian
|
94.62
|
|
No.2
|
MW052224
|
S. capracanis
|
MT772238.1
|
Iran
|
99.32
|
|
No.3
|
MW052225
|
S. hircicanis
|
KU820984.1
|
China
|
99.83
|
|
No.4
|
MW052226
|
S. hircicanis
|
KU820984.1
|
China
|
99.65
|
|
No.5
|
MW052227
|
S. capracanis
|
MT772238.1
|
Iran
|
99.66
|
|
No.6
|
MW052228
|
S. gigantea
|
L24384.1
|
Australian
|
99.66
|
|
No.7
|
MW052229
|
S. gigantea
|
L24384.1
|
Australian
|
99.66
|
|
No.8
|
MW052230
|
S. capracanis
|
MT772238.1
|
Iran
|
99.66
|
|
No.9
|
MW052231
|
S. hircicanis
|
KU820984.1
|
China
|
99.48
|
|
No.10
|
MW052232
|
S. hircicanis
|
KU820984.1
|
China
|
99.48
|
NCBI-GenBank submission
The local Sarcocystis spp. were submitted in the NCBI-Genbank database to get the Gene bank accession number for Iraqi Sarcocystis isolates in Iraq based on sequence analysis of small subunit ribosomal RNA gene (ITS1) region with the accession no. (MW052223, MW052224, MW052225, MW052226, MW052227, MW052228, MW052229, MW052230, MW052231, MW052232). Samples were recorded and waiting for the release date on the NCBI-Gen bank website.
Multiple sequence alignment analysis
Multiple sequence alignment analysis of small subunit ribosomal RNA gene in local Sarcocystis spp. goats isolate, and NCBI-Genbank Sarcocystis species isolate. The multiple alignment analysis was constructed using the Clustal (W) alignment tool (MEGA 6.0 version). That showed the nucleotide alignment similarity as (*) and substitution mutations in small subunit ribosomal RNA genes between different Sarcocystis species isolates (Figure 6).
Figure 6: Multiple sequence alignment analysis of small subunit ribosomal RNA gene in local Sarcocystis spp
Phylogenetic analysis
Phylogenetic tree analysis based on ITS-1 gene partial sequence in local Sarcocystis spp. goats isolates from Wasit province that were used for genetic Sarcocystis species identification. The phylogenetic tree was constructed using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Sarcocystis isolates No.1, No. 6, and No.7 were closely related to NCBI-BLAST S. gigantea isolates Australian (L24384.1). The local Sarcocystis isolates No.2, No.5, and No.8 were closed related to NCBI-BLAST S. capracanis isolate Iran (MT772238.1). In contrast, the local Sarcocystis isolates No.3 and No.4, No.9, and No.10 showed closed related to NCBI-BLAST S. hircicanis isolates China (KU820984.1) at total genetic changes (0.04-0.01%) (Figure 7).
Figure 7: Phylogenetic tree analysis based on ITS-1 gene sequence in local goats Sarcocystis spp.
Discussion
Sarcocystosis is a common zoonotic protozoal parasitic disease affecting a wide range of domestic ruminants, and some of them can generate significant economic losses when causing clinical and subclinical disease (16,17). Sarcocystis spp. can be distinguished into two forms: macroscopic and microscopic cysts can invade different organs of their intermediate host (18). The results showed a macroscopic cyst similar to the grain of rice milky-white in color, round to ovoid, and buried in the muscle fibers (19). The study showed the presence of several forms of microscopic cyst, including spindle, circular, elliptical, cylindrical, and twisted shapes, in the diaphragm 111.8-34.76*15.42-4.9 μm (20). The difference in shape may be due to the age of the cyst and the duration of its stay in the intermediate host. Bradyzoite (Cystizoite) characterization appeared in different forms and sizes, showing as banana form with a little pointed anterior end and rounded posterior end containing a nucleus. The results agree with what was recorded by Mohammad and Kadihm (20). In this study, the conventional PCR technique used specific forward and reverse primer designs to detect Sarcocystis spp. positive band of 608bp.The total infection rates of goats using molecular technique showed 89(89%) positive samples out of 100 that examined DNA samples in Wasit province. In Iraq, few studies reported Sarcocystosis by molecular methods; Al-Saadi et al. (15) recorded Sarcocystosis in sheep in the Karbala governorate 90.78%, and Dakhil et al. (21) recorded overall rates of S. fusiformis and S. Moulei infection in Iraqi water buffaloes were 2.8% and 0.1% respectively. The prevalence reported in 95 (90.48 %) in Selangor, Malaysia farm goats and recorded 50.4 % (61/121) in goats and in Tunisia (23), while in Brazil (24) examined 270 goat’s samples and found prevalence in goats 50.7%. The differences between this and other molecular studies results may depend on different methods used to extract genomic DNA, various factors affecting the amplicon production, the absence of the parasite in the organ, or its loss due to frequent freezing and analysis. The experience of the examiner and the number of samples have had a significant impact on the rate of infection. The DNA sequence and phylogenetic analysis are considered the most critical approaches to identifying the species of different pathogen infections and to comparing the strain of the pathogen, which may be a parasite, bacteria, virus, or another microorganism with the similar and different strain that spreads in the world (25-27). In the present study, five PCR products from 89 positive PCR samples were checked using NCBI-BLAST analysis of Sarcocystis species sequenced and compared with other Sarcocystis spp. Sequencing in Gene Bank gives an idea about the new strain of Iraqi Sarcocystis spp. in Wasit province to help control this disease. The results of DNA sequencing of goats were collected from different regions of Wasit province, which were checked using references of ITS1 gene of Sarcocystis parasite, including S. capracanis, S. hircicanis, and S. gigantea. The phylogenetic tree results showed similarities and differences between the Iraqi strain, neighboring countries, and the distant world; these indicated the highest homology with China and equal similarity with Australia and Iran. The results of a phylogenetic tree and sequence analysis of ITS1 coding gen of Sarcocystis spp. were S. hircicanis 40% (4/10) and S. capracanis 30% (3/10), Sarcocystis capracanis was found in goats’ meat samples from Brazil, Malaysia, Egypt, Tunisia and Saudi Arabia (19,28,29). Another study identified S. capracanis and S. hircicanis in domestic goats from Kunming city (30). Our study found S. gigantea 30% of S. gigantea (3/10) that infect sheep have been diagnosed in goats. To our facts, there is no information yet on S. gigantea in goats. In this study, we report the natural infection of S. gigantea in Iraqi goats for the first time in the world; the results of the phylogenetic tree indicated the highest homology with the Australian strain of S. gigantea 99.62 to 99.66% identity; previously, a species of Sarcocystis that infects sheep in goats has been diagnosed for the first time by Hong et al. (30) who recorded 2.91% as positive for S. tenella by light, electron microscopic and molecular examination in Korean native goat. This convergence and divergence of findings among countries are due to the diversity in the resemblance between the breeds isolated in Iraq and the world breeds separated in groups far from Iraq.
Conclusion
According to the molecular study, Sarcocystis hircicanis and Sarcocystis capracanis are the main distribution species in goats in Wasit province, Iraq. The molecular research first recorded Sarcocystis gigantea in a goat in Iraq.
Acknowledgments
The authors thank the College of Veterinary Medicine, University of Baghdad, for their assistance and cooperation.
Conflict of interest
The authors declared that there is no conflict of interest.