Introduction
Camels are characterized by their high resistance to many pathogenic and zoonotic microorganisms and ability to adapt to extreme desert ecosystems compared to other animals in the same area (1). Bessalah (2) pointed to camel diarrhea as the main cause of economic loss associated with poor growth, medication costs, and animal death. In the Camelidae members, many types of Escherichia coli (E. coli) have been detected in fecal samples from diarrheic and non-diarrheic camels only, then E. coli O157:H7 strains were isolated from sick camels were recorded; these results can provide evidence on the role of infected camels by Shiga toxin-producing E. coli in the human outbreaks (3). Escherichia coli O157:H7 is a foodborne bacterium that can be isolated from the feces of animals and meat and meat products, dairy products, vegetables, and contaminated water. WHO recommended that developing countries be attended to detect this pathogen as a research priority (4-8). The major problem in camels was the high mortality rate in camel calves aged 1-3 months, and the causes are mainly infectious diseases and poor management practices (9). Like all other animals, Camels suffer from various signs, including diarrhea caused by different bacterial antigens, such as the E. coli pathogen detected in neonatal calve camels with diarrhea (10). Enterohemorrhagic Escherichia coli (EHEC) causes hemolytic uremic syndrome and hemorrhagic colitis in humans. Escherichia coli O157:H7 This pathogen was first recognized in 1982 (11), As this is related to hamburgers (undercooked) consumption. It has been found that the cattle were harboring E. coli O157:H7, so ruminants were now recorded as a main reservoir, Shiga toxigenic Escherichia coli (STEC) O157:H7, was detected in other animal species (12). In addition, E. coli O157:H7 has been detected in fecal samples of apparently healthy cattle with diarrhea (13), camels (14), dogs (15), and zoo animals (16). Isolation of these pathogens using bacteriological methods is a big challenge, and the PCR analysis for identifying this bacterium is essential in all animals (13-17). Molecular assays are precise and rapid for confirmation as compared with cultural methods. Moreover, sequence analysis is suitable for delineating species and tracking epidemiology (18). The protein encoded by the gene RfbE on E. coli O157 was perosamine synthetase with monosaccharide component synthetase associated with the biosynthesis of O Ag in the bacterial LPS (19). As the bacteria bind the intestine's mucosa and grow, they secrete Shiga toxin (Stx) toxins. This toxin was a substantial virulence factor in E. coli. The toxin Stx2 is more toxic than Stx1 for cells of the endothelial renal artery (20). Shiga toxin-producing E. coli was responsible for causing diarrhea. Adamu and Collages (21) recorded that the E. coli STEC isolated from camel fecal samples possessed virulence genes (Stx1, Stx2, and Stx1 with Stx2). Salehi (3) isolated 2 E. coli O157:H7 strains from diseased camels using E. coli DNA microarray. The two isolates displayed positive hybridization signals for Locus of enterocyte effacement (LEE) gene probes for stx1 and stx2. Hussein and Yousif (13) detected stx2 and stx1 from E. coli O157:H7 isolated from calves in Baghdad by conventional PCR.
This study aimed to determine the occurrence of E. coli isolates from diarrheic and apparent healthy camels with the bacterial and molecular assay of E. coli O157:H7 that separated camels in some Iraqi provinces, and study the genetic diversity and sequencing of this microorganism,
Materials and methods
Ethical approved
The research and ethical committee of Vet approves the study. Medicine College (Book No. 39 / D A on 7/12/ 2021). University of Baghdad, Iraq.
Animals
Two hundred and fifty camels aged one day to 7 years from both sexes were conducted for this study, which extended from January 2021 to December 2021. Although located in three provinces, Karbala, Najaf, and Al-Muthana, some camels suffer from diarrhea, and others without diarrhea. All other clinical signs were recorded.
Sample collection and bacteriological examination
Two hundred and fifty Fecal samples were taken from camels. The samples to be analyzed for bacteria were tagged and then placed in their sterile test tubes, which were then stored in ice boxes. They were brought to the Veterinary Medicine Laboratory. Culturing of these samples on MacConky and EMB /incubated aerobically for 24 to 48 hrs at 37°C. Gram stain and biochemical tests were done on the suspected E coli isolates identified by Catalase, Oxidase, Indole, MR- VP test, Simmon's Citrate, Motility, and TSI. (22). Then sub-cultured on selective Hichrome O157agar.
Molecular study
DNA of the four E. coli O157:H7 isolates were extracted by (Addprep bacterial genomic DNA extraction Kit) according to the manufacturer company (Addbio (Korea). Nanodrop spectrophotometers were used to estimate the purity and concentration of extracted DNA. Four primers were used (Table 1). For detecting the virulence genes, the PCR amplification mixture includes the master mix (12.5μl), two μl of DNA (template), 2μl of each F and R primers, and nuclease-free water (6.5μl) to complete the mixture to volume 25μl. The PCR reaction was done of the Thermal-Cycler utilizing (Biobase(china), the conditions optimized for the four primers: 1 cycle (94ºC/3 minutes.) for the initial denaturation, 35 cycles at (94ºC/60 sec.) for denaturation. The Annealing temp for Stx1 and Stx2 genes were (61.5ºC/30 sec.) and for RfbE. FLIC genes were (60ºC/30 sec.) and (72ºC/60 Sec.) for an extension for each gene, then followed by one cycle [72ºC/ seven minutes] for the final extension. The PCR products were examined in electrophoresis in 2% agarose gel using a 100 DNA ladder (Qiagen, Germany). Then, visualization of DNA bands by a UV transilluminator (Clinx Science/ China).
Table 1: Primers used in current study
|
Primers
|
Sequence (5- to 3-)
|
Product size (bp)
|
Reference
|
|
RfbE
|
F
|
AAG ATT GCG CTG AAG CCT TTG
|
497
|
14
|
|
R
|
CATTGGCATCGTGTGGACAG
|
|
Stx1
|
F
|
ATAAATCGCCATTCGTTGACTAC
|
180
|
23
|
|
R
|
AGAACGCCCACTGAGATCATC
|
|
Stx2
|
F
|
GGCACTGTCTGAAACTGCTCC
|
255
|
23
|
|
R
|
TCGCCAGTTATCTGACATTCTG
|
|
FliC
|
F
|
GCGCTGTCGAGTTCTATCGAGC
|
625
|
24
|
|
R
|
CAACGGTGACTTTATCGCCATTCC
|
DNA Sequence
All PCR-positive samples for the amplified RfbE were sent to South Korea for sequence analysis, and the data obtained were analyzed using Bio Edit software (version 7.5.0.3) for multiple sequence alignment through homology with global sequences in different countries. MEGA 11.0 was used to construct the pf phylogenetic tree, and the homology sequence was identified in the NCBI -GenBank-NCBI.
Results
Identification of E. coli O157:H7
Culturing 250 fecal samples revealed the isolation of 117 E. coli (46.8%) on MacConky (pink colonies), and EMB showed a green metallic sheen. Four isolates only showed a purple color on selective CHROM agar™ for E. coli O157 (Figure 1). Gram stain revealed Gram-negative bacterium, and confirmation by different biochemical tests given a negative for VP, Simmon's citrate, and positive for indole and motility tests, on TSI revealed yellow with/without gas production.
Figure 1: On the right, E. coli on EMB and MacConkey agar and E. coli O157 H7 on Chrome agar.
Percentage of infection
From 250 fecal samples of camels, 117 (46.8) samples were positive for E. coli bacteria, and only four isolates were diagnosed as E. coli O157:H7 at a percentage of 1.6% (4/250). Moreover, according to E. coli, the rate was 4/117(3.41%).
Clinical study
On clinical examination, 113 of 117 camels affected with E. coli showed clinical signs of illness, including diarrhea (semi-solid to watery feces with yellow color), pale mucous membranes, fever, and depression. The four camels affected with E. coli O157: H7 showed the same signs, and only one camel had bloody diarrhea (Figure 2).
Figure 2: Camel affected with Bloody diarrhea.
Molecular study
Out of 117 fecal samples of E. coli, only four isolates possessed the four genes used in this study and showed the amplified DNA of all four isolates had 497 bp for the RfbE gene (Figure 3), 625 bp for the FliC gene (Figure 4), 180 bp for Stx1(Figure 5), 255 bp for Stx2 (Figure 6).
Figure 3: PCR amplicons RfbE gene with product size 497 bp.
Figure 4: PCR amplicons after amplification of FLiC gene of product size 625pb.
Figure 5: PCR amplicon after amplification of Stx1 gene with product size 180pb.
Figure 6: PCR amplicon after amplification of Stx2gene with product size 225pb.
Sequencing
The four samples positive to RfbE by PCR were taken for gene analysis, and the sequences of this gene were made available at NCBI-GenBank under the accession numbers: E. coli O157H7; LC74356.1, LC743562.1, LC743563.1 and LC743564.1, variation in taxonomic detection depended in query coverage, A phylogenetic tree (Figure 7) of E. coli O157H7 revealed that the four bacterium isolates investigate in the current study clustered in one clade: Clade 1 (CP103864.1 and CP038496.1) with 79% similarity between isolates, 81% similarity with anther clade two which include all our sequence isolates (LC74356.1, LC743562.1, LC743563.1 and LC743564.1) with 100% similarity.
Figure 7: Phylogenetic tree of RfbE gene of E. coli O157H7 with different global isolates.
Discussion
Even though colibacillosis leads to severe clinical signs in the camel, including economic losses for farmers, there is minimal information about the virulence factors expressed by pathogenic E. coli. For example, there is a poor understanding of the etiology of colibacillosis in camel herds. Several studies explained the isolation of E. coli from camels. Therefore, this study was conducted to illuminate the virulence genes of E. coli O157:H7 strains isolated from the feces of diarrheic and healthy camels. This study showed the isolation of 117 isolates of E. coli from 250 fecal samples from camels 46.8%. These results were incompatible with a survey by Al-Ruwaili (25), who isolated E. coli in a high percentage of 58.2% in diarrheic camels. Besalah (2) observed 53 isolates 65.4% of E. coli from camels in herds with diarrhea. This study showed the isolation of 4 (1.6%) E. coli O157:H7 isolates from total 250 fecal samples with confirmation of 4 genes (RfbE, O157, Stx1, Stx2, and FliC) in these isolates. This Percentage of 1.6% was lower than the study by Admau (21), who found the percentage of STEC isolated from camels was 3.8% Maiduguri and Bosilevac (2) recorded a prevalence of 10.7% in Riyadh, Saudi Arabia. In contrast, El-Sayed (26) didn't detect E. coli O157 among four hundred fecal samples from camels collected from Somalia, Egypt, Djibouti, Sudan, and Kenya; they explained that this occurred due to the life pattern of camels in the desert that minimizes contact of animals with camels and therefore minimize the transmission of this bacteria.
Also, Moore (27) in the United Arab Emirates failed to diagnose E. coli in the feces of camel calves. Najim (28) studied the survival of E. coli O157 in produced cheese locally in Baghdad province and demonstrated a high percentage of infection, 45.84%. This difference in the infection rate is due to differences in management and living conditions. Also, an increased number of infections are in dairy products or slaughterhouses due to direct transmission between carcass or from workers, as well as rapid transmission in food products such as meat and dairy products, transmission in food products such as meat and dairy, so this required searching for new and better methods for accurate diagnosis of this essential bacteria.
The essential clinical sign that appeared on camels was diarrhea, which occurred due to the Shiga toxin produced by E. coli O157:H7 in the intestine and acts on sensitive cells of organs. STEC colonizes the epithelium of the intestine, particularly in the mucosa adjacent to the anorectal junction (29). In addition, a study by Al-Taii (30) concluded that E. coli O157:H7 caused changes in kidney and liver function in an experimental study on rabbits more severe at fifteen- and thirty-days post-infection.
Our study revealed that the four isolates of E. coli O157:H7 possessed four genes, fliC, Rfb, stx1, and stx2, by PCR assay. This is compatible with many studies on these bacteria; Yousif (31) diagnosed E. coli O157:H7 using RT PCR, detected flic and Rfb genes and concluded the importance of these genes on the pathogenesis of this bacteria in dogs. Another Hassan (30) study detected rfb and Flic genes in E. coli O157:H7 isolates from diarrheic calves. Also, Sallam (6) isolated from the meat of camels 24 isolates as E. coli O157:H7 by Multiplex PCR and revealed the existence of four genes. Also, these results were similar to other studies, Adamu (21) recorded (stx1, stx2, and mixed) in isolates from camel fecal Salehi (3) isolated two E. coli O157:H7 strains possess stx1 and stx2. Hussein and Yousif (13) also detected stx2 and stx1 in E. coli O157:H7 isolates from calves in Baghdad. On the other hand, stx2 was shown to be the most frequently identified in human isolates with a percentage 45.5% (21). The Diagnostic methods using molecular assay are more accurate and faster than the traditional bacterial culturing methods for diagnosing different bacteria (18).
All sequence isolates were found in one node and branch length with no distance scale (100% identity); among other global sequence isolates, our results were found near sequences with accession numbers (CP062774.1 and LC739728.1) from France and Iraq, respectively. It was different from other sequences isolated in different countries.
Conclusion
the study showed that occurrences of E. coli O157:H7 strains in camels acted as a source of infection that transmitted infection to humans. Furthermore, E. coli O157:H7 was detected in fecal collected from camels. PCR assay revealed possession of this bacteria's four virulence genes and the presence of 4 combinations of virulence factors that increase isolates' pathogenicity. Therefore, isolating this micro-organism in Iraq will be essential for researchers to investigate future prevalence studies.
Acknowledgments
The researcher of this study was supported by the Department of Internal and Preventive Medicine, College of Veterinary Medicine, University of Baghdad.
Conflict of interest
There is no conflict of interest, and the authors declare