Introduction
Food safety remains a growing concern globally; the incidence of foodborne diseases is rising, causing significant morbidity and mortality rates. Developing countries, particularly those in the continents of the Middle East and North Africa, face considerable challenges in managing these diseases (1). One of the particularly serious foodborne illnesses is listeriosis, brought about by the bacterium Listeria monocytogenes (2). The prevalence of listeriosis varies by country and can vary between 0.1 and 11.3 occurrences for every million people (3). Listeriosis outbreaks linked to food are frequent in Egypt, and sporadic disease cases persist in various countries, such as the USA in 2015 and England in 2020, where ice cream and food or a food environment were implicated, respectively (4). The common, gram-positive, rod-shaped bacteria Listeria monocytogenes is a member of the Listeriaceae family, which currently comprises 20 different species of Listeria (5). Only two species, L. ivanovii, and L. monocytogenes, are known to be pathogenic. L. ivanovii is mostly associated with animal foodborne outbreaks and infrequently linked to human infections, while L. monocytogenes is the main cause of listeriosis in humans (6). Listeria monocytogenes can tolerate a wide range of environmental challenges, making it a significant burden for the global food sector and health agencies. It can thrive within a pH range of 4.3-9.6, although a neutral pH is optimal for growth (7). As a psychrotroph, the organism can survive within a range of 0.5-45°C; nevertheless, it prefers temperatures around 30-37°C (7). Additionally, the bacterium is capable of long-term survival in frozen food items (8). Moreover, L. monocytogenes can resist desiccation, acid, heat, and disinfectants by developing surface biofilms (9). Furthermore, it has an exceptional capacity for survival in 20% NaCl (10). Listeria monocytogenes has a wide host range including humans, as well as wild and domestic animals that typically become infected by the ingestion of food or feed that has been contaminated with L. monocytogenes (11). Fish is a highly nutritious food that is widely marketed and consumed as a result of containing proteins with biological value and digestibility as well as lipids, mostly unsaturated fatty acids, vitamins, and minerals. Food that has been contaminated is the primary means of Listeria transmission in about 99% of instances (12). L. monocytogenes in fishes is likely from polluted waterways or during handling and processing with contaminated environments and equipment (13,14). The bacterium has frequently been isolated from fish and fish products acting as vehicles worldwide (15,16). Vegetables have also been noted as a potential cause of listeriosis for humans; this can occur directly through consuming contaminated raw vegetables or indirectly through consuming milk from animals that have ingested contaminated fodder or silage. In the last decade, there has been a significant increase in studies reporting the presence of L. monocytogenes in ready-to-consume fruits and vegetables. The prevalence of this bacterium has been estimated to range from 0.04% to 36.8% in various products, including cabbage, strawberries, cauliflower, celery, cucumber, carrots, herbs, lettuce, and cucumber (17). Globally, invasive listeriosis in humans is responsible for 20-30% of fatal cases. This condition is characterized by the invasion of the brain, bloodstream, or placenta, resulting in symptoms such as encephalitis, meningitis, and septicemia (18). Invasive listeriosis is commonly observed in immunocompromised people, neonates, older individuals, and pregnant women. However, it can occasionally affect healthy individuals. Many risks are related to the organism’s existence during pregnancy, which may be asymptomatic or linked to vaginal infection in females, including the possibility of stillbirth, abortion, or significant neonatal complications. However, milder forms of listeriosis can result in symptoms such as nausea, persistent fever, vomiting, and flu-like illnesses, including chills, exhaustion, and muscle and joint pain (19). Essential genes must be present in the L. monocytogenes genome to cause infections in humans and animals and to be expressed under the appropriate conditions. Listiriolysine O (LLO) and internalin, which are expressed by the hlyA and internalin (inl) genes, respectively, are among the several virulence factors present in L. monocytogenes (20). The hly gene is involved in how L. monocytogenes controls the host cell. InlA may be involved in L. monocytogenes’ penetration of intestinal epithelial cells by expressing the E-cadherin receptor. The inlA fragment contributes to L. monocytogenes’ invasiveness and might distinguish invasive bacteria from noninvasive ones (21). Antibiotic resistance among foodborne bacteria, like Listeria monocytogenes, has been considerably enhanced by the increased use of antibiotics in recent years, which has occasionally led to their abuse in humans and animals (22). Recently, antibiotic resistance has increased in strains of L. monocytogenes from foodstuffs, the environment, and clinical samples., particularly those frequently employed to treat listeriosis. The resistance development among strains is usually affected by antibiotic usage in animals and people and geographic differences. Most L. monocytogenes strains are inherently resistant to cephalosporins and fluoroquinolones of the third and fourth generations currently in use, which may negatively impact human health (23). Fast pathogen identification in food products is essential for the diagnosis of food illness and for monitoring food safety (24).
Consequently, the current research sought to assess the presence of L. monocytogenes in fish, vegetables, and humans in Qena Governorate, Egypt, using both conventional and molecular approaches, in addition to the virulence gene profile, antimicrobial sensitivity and phylogenetic analysis of the recovered isolates.
Materials and methods
Ethics approval and consent to participate
The South Valley University ethical committee in Qena, Egypt, approved this study (No. 8b/16.01.2021). Additionally, each participant's agreement had been gotten orally.
Study design and sampling
This research was carried out in Qena Governorate of Egypt, which is located approximately 576 km from Cairo, between February 2021 and November 2022. The entirety of 345 different samples were gathered and investigated. Our samples included 115 fish, 25 swabs from fish containers, and 90 vegetable samples obtained randomly from various markets and supermarkets in Qena, Egypt, and were immediately transported in ice boxes to the laboratory for bacteriological analysis.
For each fish sample, 25 grams of the interior flesh content, including the freshly caught and frozen fish slime and 25 grams from every vegetable, were mixed for 2 minutes in 225 ml of Listeria selective broth base (HiMedia, M889, India). The collected fish containers were swabbed using sterile cotton swabs. Then they put in screw-capped tubes with 5 ml of Listeria selective broth base (HiMedia, M889, India). On the other hand, 90 samples of diarrhea from patients admitted to clinical labs in Qena with gastrointestinal issues and diarrhea were used in the human survey. The age, sex, and residence of each patient were recorded. In addition, 25 hand swabs were collected from fishermen. The fecal and hand swabs were collected in sterilized screw-capped tubes with 5 ml of Listeria selective broth base.
Listeria monocytogenes isolation and identification
- monocytogenes was isolated by samples were pre-enriched for Listeria species by incubation in Listeria selective broth base (HiMedia, M889) with Listeria Selective Supplement II, modified (HiMedia, India) at 35°C for two days (25). A loopful from the Listeria Selective Broth Base culture was used to streak on Oxford Medium Base (HiMedia, M1145, India) with Oxford Listeria supplement (HiMedia, Modified FD172, India) followed by incubation at 35°C for two days. Five potential colonies were cultured on tryptone soya agar (Himedia, M291, India) plus 0.6% yeast extract (TM MEDIA) and incubated at 37°C overnight. The purified colonies were identified biochemically by performing a gram staining, catalase procedure, β-hemolytic activity, motility procedure at 25°C and 37°C, and CAMP procedure (26).
DNA extraction
The ABT bacterial DNA Mini Extraction Kit was employed to obtain genomic DNA from L. monocytogenes cultures following the guidelines provided by the manufacturer (spin column) (cat. no. ABT001). The obtained DNA was maintained at -20°C till it was needed.
PCR amplification
In this study, the primers used were obtained from Metabion (Germany); according to Dalmasso et al. (27) and Kumar et al. (28) and two additional primers were designed in this study (Table 1). The experimental protocol involved adding 1 µl of each 10 pmol primer to a 25 µl reaction mixture consisting of 12.5 µl of WizPure PCR 2X Master (W1401), 5 µl of DNA template, and 5.5 µl of nuclease-free water (Qiagen, Germany). The reactions were performed under different conditions for each primer set as follows: primary denaturation at 94°C for 5 min followed by 35 cycles of 94°C-30 sec denaturation for all primers, while 55°C-40 sec annealing, 72°C-45 sec extension, and 72°C-10 min final extension for Listeria 16S rRNA (437 bp); 60°C-40 sec annealing, 72°C-1.2 min extension, and 72°C-12 min final extension for Listeria monocytogenes 16S rRNA(1200 bp); 59°C-30 sec annealing, 72°C-30 sec extension, and 72°C-10 min final extension for inlA gene (380 bp); 58°C- 30 sec annealing, 72°C-45 sec extension, and 72°C-10 min final extension for hlyA gene (501 bp). One hundred milliliters of TBE buffer made 1.5% agarose gel. Five µl of DNA ladder (100 bp ladder, Diagnostic Biotech, M1060) and ten µl of negative control, positive control, and PCR product were loaded onto the gel. Electrophoresis was carried out at 80 volts for 45 minutes using a power supply (Cleaver Scientific Ltd., NanoPAC-300, England). Finally, the gel documentation system took the result of the gel (Cleaver Scientific Ltd., England).
Table 1: Primers for the L. monocytogenes genes used in this investigation
|
Target gene
|
Primer sequence
|
References
|
|
Listeria 16S rRNA
|
CCTAATACATGCAAGTCGAA
ACAAGCAGTTACTCTTATCCTT
|
27
|
|
L. monocytogenes 16S rRNA
|
GGACCGGGGCTAATACCgAATgAT AA
TTC ATG TAG GCG AGT TGC AGC CTA
|
28
|
|
inlA
|
CAGGCAGCTACAATTACACAAGA
AGCGGGTCTATATCCGTTATCT
|
Our study
|
|
hlyA
|
ACCTACAAGACCTTCCAGATTTTTC
GCAACGTATCCTCCAGAGTG
|
Phenotypic detection of antibiotic resistance
Antibiotics were selected based on their widespread use and availability in the investigation areas for both animal and human treatment. The antimicrobial resistance test was conducted using the disc diffusion approach on Muller-Hinton agar plus 5-10% sheep RBCs, following the National Committee for Clinical Laboratory Standards (29) guidelines. This study evaluated the susceptibility of eight antibiotics (Oxiod®) at the following concentrations (μg/ml): gentamicin (10), chloramphenicol (30), amoxicillin-clavulanic acid (10), tetracycline (30), enrofloxacin (5), trimethoprim-sulphamethoxazole (25), ciprofloxacin (10), and ampicillin (10). According to Singh et al.'s (30), each isolate's multiple antibiotic resistance (MAR) index has been estimated.
Sequencing of Listeria 16S rRNA gene and Phylogenetic analysis
The 16S rRNA gene PCR products for seven Listeria monocytogenes isolates, including one each from fishermen’s hand swabs (HS5), cauliflower (VC4), tilapia (TF1), catfish (CF2), and fish containers swabs (FC3), as well as two isolates from diarrheal swabs (DS6 and DS7), were purified employing the QIA quick extraction kit (Qiagen, Valencia, CA). The Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer) was used to sequence the resulting refined products employing an Applied Biosystems 3130 Sequencer (ABI, USA). The sequence reaction was purified using Centrisep (spin column) according to the instructions for Cat. No. CS-901 of 100 reactions; To identify the sequences and assign them to GenBank, an initial analysis was conducted employing the Basic Local Alignment Search Tool (BLAST®) (31). The resulting sequences were then submitted through BLAST similarity and phylogenetic analysis employing the neighbor-joining method through the Mega 6 program (32).
Statistical analysis
the data were statistically analyzed by using SPSS version 22. The relationship between variables has been established using Fisher's exact and Monte Carlo tests. Fisher’s exact test evaluated the null hypothesis of independence. At the same time, Monte Carlo simulation modeled the possibility of several outcomes in a process that was challenging to anticipate because it involved random variables. A p-value of less than 0.05 was regarded as statistically significant for the variations in prevalence rates. Odds ratios (ORs) and 95% confidence intervals (CIs) were estimated for every variable. The diagnostic accuracy approach assessed the degree of agreement with the two diagnostic techniques used through the McNemar test.
Results
Occurrence of Listeria monocytogenes in various source
Table 2, figures 1 and 2 present data indicating that the occurrence of Listeria monocytogenes in this study was substantially greater when detected using the conventional method (11.30%, obtained from 39 out of 345 samples) compared to the PCR test (3.48%, obtained from 12 out of 345 samples). The occurrences of L. monocytogenes in fish, fish containers, and vegetables were 8.70 and 3.48, 20 and 8, and 18.89 and 1.11% by conventional method and PCR, respectively. On the other hand, 6.09% and 4.35% of the samples obtained from humans tested positive for Listeria monocytogenes using conventional methods and PCR tests, respectively. The detection of L. monocytogenes and the source of the tested samples were significantly associated (Figures 1 and 2.
From Table 3, it is certain that fresh fish harbor Listeria monocytogenes at 12.31% and 6.15% by conventional method and PCR, respectively. Fresh fish of two species were investigated, tilapia and catfish, with the acquisition of L. monocytogenes occurrence in tilapia and catfish as 5 and 8%, respectively. In contrast, the traditional approach revealed a 4% (2/50) incidence of L. monocytogenes in frozen fish, which PCR could not confirm. A statistically insignificant difference was found between L. monocytogenes incidence in fresh and frozen fish (value = 3.809; p = 0.113).
Regarding the vegetable samples, L. monocytogenes was detected in parsley and lettuce at 26.67% and 13.33%, respectively, using the conventional method, but PCR could not confirm it. In the case of cauliflower, L. monocytogenes was detected in 5 samples (16.67%) using the conventional method. Still, PCR confirmed only one sample (3.33%). However, the association between the results obtained by the two methods was statistically insignificant (χ2 = 1.84; p = 1.000) (Table 4).
Table 2: Occurrence of Listeria monocytogenes in the investigated samples using conventional method and PCR test
|
Sources
|
No. examined
|
+ve L. monocytogenes No. (%)
|
X2 (P)
|
Odds ratio
|
|
Conventional methods
|
PCR
|
|
Fish
|
115
|
10 (8.70)
|
4 (3.48)
|
0.000*
|
1.261(0.33-4.822)
|
|
Fish container
|
25
|
5 (20)
|
2 (8)
|
0.523(0.095-2.862)
|
|
Vegetables
|
90
|
17 (18.89)
|
1 (1.11)
|
4.045(0.464-35.259)
|
|
Human
|
115
|
7 (6.09)
|
5 (4.35)
|
References
|
|
Total
|
345
|
39 (11.30)
|
12 (3.48)
|
|
|
* The significant level at P ˂ 0.05
Figure 1: Agarose gel electrophoresis of Listeria 16S rRNA gene showing clear bands at 437 bp L: 100 bp ladder, P: positive control, N: negative control, lane 1 and 2 isolates from tilapia, lane 3 and 4 isolates from catfish, lane 5 and 6 isolates from fish containers, lane 7 isolate from cauliflower, lane 8-11 isolates from diarrheal samples, lane 12 isolate from hands of fishermen.
Figure 2: Agarose gel electrophoresis of L. monocytogenes 16S rRNA gene showing clear bands at 1200 bp L: 100 bp ladder, P: positive control, N: negative control, lane 1 and 2 isolates from tilapia, lane 3 and 4 isolates from catfish, lane 5 and 6 isolates from fish containers, lane 7 isolate from cauliflower, lane 8-11 isolates from diarrheal samples, lane 12 isolate from hands of fishermen.
Table 3: Occurrence of Listeria monocytogenes in the investigated fish samples using conventional method and PCR test
|
Sources
|
No. examined
|
+ve L. monocytogenes No. (%)
|
Monte Carlo
X2 (P)
|
Odds ratio
|
|
Conventional methods
|
PCR
|
|
Tilapia (Fresh)
|
40
|
4 (10)
|
2 (5)
|
3.809 (0.113)
|
0.61(0.08 -4.6)
|
|
Catfish (Fresh)
|
25
|
4 (16)
|
2 (8)
|
|
Frozen fish
|
50
|
2 (4)
|
0 (0)
|
|
Total
|
115
|
10 (8.70)
|
4 (3.48)
|
|
|
Table 4: Occurrence of Listeria monocytogenes in the investigated vegetable samples using conventional method and PCR test
|
Sources
|
No. examined
|
+ve L. monocytogenes No. (%)
|
Monte Carlo
X2 (P)
|
Odds ratio
|
|
Conventional methods
|
PCR
|
|
Parsley
|
30
|
8 (26.67)
|
0 (0)
|
1.84 (1.000)
|
NA
|
|
Lettuce
|
30
|
4 (13.33)
|
0 (0)
|
|
Cauliflower
|
30
|
5 (16.67)
|
1 (3.33)
|
|
Total
|
90
|
17 (18.89)
|
1 (1.11)
|
|
|
Occurrence of L. monocytogenes in humans
Table 5 indicates that L. monocytogenes was isolated from hand swabs of fishermen using the conventional method with a percentage of 20%, which was higher than that detected by PCR 4%. However, both methods detected L. monocytogenes in diarrheal samples with the same percentage of 4.44%. Fishermen and diarrheal people infected with the organism did not differ significantly from one other (p = 0.509, odd ratio 0.061-5.601).
A total of 90 diarrheic patients (35 men and 55 women) between the ages of 5 and 56 years participated in this study. Patients aged 5 to 17 years and 31 to 43 had the highest incidences of L. monocytogenes 5.71% and 5.26%, respectively, followed by patients aged 18 to 30 (3.70%). However, patients aged 44 to 56 showed no evidence of the infection. Listeria monocytogenes was more common in females 7.27%, 4 out of 55 than in males who did not have the infection. Furthermore, L. monocytogenes was more frequent in individuals residing in urban areas 4.76% than in rural areas 3.70%. However, the difference was not statistically significant (Table 6).
Table 7 demonstrate the occurrences of L. monocytogenes virulence factors, where the inlA virulence gene was found in all 12 isolated strains. In contrast, only five isolates contained the hlyA virulence gene, distributed as two fish isolates and one isolate each from fish containers, vegetables, and humans (Figures 3 and 4).
Table 5: Occurrence of Listeria monocytogenes in the investigated human samples using conventional method and PCR test
|
Sources
|
No. examined
|
+ve L. monocytogenes No. (%)
|
Fisher's Exact Test
|
Odds ratio
|
|
Conventional methods
|
PCR
|
|
Faecal
|
90
|
4 (4.44)
|
4 (4.44)
|
0.509
|
0.583(0.061-5.601
|
|
Hand
|
25
|
5 (20)
|
1 (4)
|
|
Total
|
115
|
7 (6.09)
|
5 (4.35)
|
|
|
Table 6: Occurrence of L. monocytogenes in human samples according to age, sex, and residence using the PCR test
|
Variables
|
No. examined
|
+ve L. monocytogenes No. (%)
|
Monte Carlo Value (P)
|
Odds ratio
|
|
Age (year)
|
|
5-17
|
35
|
2 (5.71)
|
2.304(0.502)
|
4.143 (0.332-51.764)
|
|
18-30
|
27
|
1(3.70)
|
3.71 (0.205-67.149)
|
|
31-43
|
19
|
1(5.26)
|
2.714 (0.149-49.533)
|
|
44-56
|
9
|
0(0)
|
Reference
|
|
Sex
|
|
Males
|
35
|
0(0)
|
1.000
|
0.559 (0.060-5.188)
|
|
Females
|
55
|
4(7.27)
|
|
Residence
|
|
Urban
|
63
|
3(4.76)
|
1.000
|
1.250 (0.201-7.778)
|
|
Rural
|
27
|
1(3.70)
|
Table 7: Occurrence of some virulence genes in Listeria monocytogenes isolates obtained from the examined samples
|
Sources
|
No. isolates
|
inlA gene No. (%)
|
hlyA gene No. (%)
|
Monte Carlo Sig
|
|
Fish
|
4
|
4(100)
|
2(50)
|
0.9444 (0.814691)
|
|
Fish container
|
2
|
2(100)
|
1(50)
|
|
Vegetables
|
1
|
1(100)
|
1(100)
|
|
Human
|
5
|
5(100)
|
1(20)
|
|
Total
|
12
|
12(100)
|
5(41.67)
|
|
Figure 3: Agarose gel electrophoresis of L. monocytogenes for detection of inlA virulence gene showing clear bands at 380 bp. M: 100 bp ladder, P: positive control, N: negative control, lane 1 and 2 isolates from tilapia, lane 3 and 4 isolates from catfish, lane 5 and 6 isolates from fish containers, lane 7 isolate from cauliflower, lane 8-11 isolates from diarrheal samples, lane 12 isolate from hands of fishermen.
Figure 4: Agarose gel electrophoresis of L. monocytogenes for detecting hlyA virulence gene showing clear bands at 501bp. M: 100 bp ladder, P: positive control, N: negative control, lane 1 and 2 isolates from catfish, lane 3 isolate from the fish container, lane 4 isolate from cauliflower, lane 5 isolate from hands of fishermen.
Antibiotic resistance profile of L. monocytogenes
Table 8 presents the antimicrobial resistance profile of Listeria monocytogenes isolates, with all isolates exhibiting resistance to ampicillin 100 and 50% of the isolates being gentamicin resistant. The highest susceptibility levels were observed for enrofloxacin 100%, followed by amoxicillin-clavulanic acid and chloramphenicol 91.67% each, and a moderate level of sensitivity to tetracycline 75%. The highest MAR value of 0.625 was recorded for an L. monocytogenes isolate obtained from a diarrheal swab (Table 9). The mean MAR index for L. monocytogenes isolates was 0.271, ranging from 0.125 to 0.625. Among our isolates, 25% had a MAR value of less than 0.2, whereas 75% had a MAR index higher than 0.2. Moreover, 3 out of 12 Listeria monocytogenes isolates 25% have been identified to be multidrug resistant.
Table 8: Antimicrobial resistance of Listeria monocytogenes strain
|
Antimicrobial agents
|
Resistant No. (%)
|
Intermediate No. (%)
|
Susceptible No. (%)
|
|
Gentamycin
|
6(50)
|
1(8.33)
|
5(41.67)
|
|
Chloramphenicol
|
0(0)
|
1(8.33)
|
11(91.67)
|
|
Amoxicillin-clavulanic acid
|
1(8.33)
|
0(0)
|
11(91.67)
|
|
Tetracycline
|
3(25)
|
0(0)
|
9(75)
|
|
Enrofloxacin
|
0(0)
|
0(0)
|
12(100)
|
|
Ciprofloxacin
|
1(8.33)
|
5(41.67)
|
6(50)
|
|
Sulfamethoxazole-trimethoprim
|
3(25)
|
1(8.33)
|
8(66.67)
|
|
Ampicillin
|
12(100)
|
0(0)
|
0(0)
|
Table 9: Antimicrobial resistance profile of Listeria monocytogenes isolates
|
No.
|
Sources of isolates
|
Antimicrobial resistance profile
|
MAR index
|
|
1
|
Hand swab
|
AM
|
0.125
|
|
2
|
Fish container swab
|
AM
|
0.125
|
|
3
|
Fish container swab
|
TE, AM
|
0.25
|
|
4
|
Tilapia
|
CN, SXT, AM
|
0.375
|
|
5
|
Tilapia
|
AM
|
0.125
|
|
6
|
Catfish
|
TE, AM
|
0.25
|
|
7
|
Catfish
|
CN, AM
|
0.25
|
|
8
|
Vegetable
|
SXT, AM
|
0.25
|
|
9
|
Diarrheal swab
|
CN, AM
|
0.25
|
|
10
|
Diarrheal swab
|
CN, AM
|
0.25
|
|
11
|
Diarrheal swab
|
CN, AMC, TE, CIP, AM
|
0.625
|
|
12
|
Diarrheal swab
|
CN, SXT, AM
|
0.375
|
|
Average 0.271
|
Phylogenetic analysis
Seven strains of Listeria monocytogenes were subjected to phylogenetic and sequence analyses of the 16S rRNA gene. The findings demonstrated that the tested isolates shared a striking genetic similarity with other L. monocytogenes strains from various sources submitted to the GenBank database. These sequences, with the accession numbers OQ024047, OQ024048, OQ024049, OQ024050, OQ024051, OQ024052, and OQ024053, were uploaded to the GenBank. They were isolated from swabs taken from fishermen's hands, cauliflower, tilapia, catfish, and fish containers, as well as two isolates from diarrheal swabs, respectively (Figures 5).
Phylogenetic and sequence analyses of the 16S rRNA gene illustrated that our examined strains demonstrated a complete similarity 100% to the Listeria monocytogenes strain isolated from caprine in the USA with accession No. CP062127. Furthermore, they displayed great similarity rates with Listeria monocytogenes strains isolated from beef sausage in the USA 99.8%, cheese in Austria 99.8%, patients with cystic fibrosis in Canada 99.1% with the accession numbers CP068977, FR733650, and EU090894, respectively.
Our seven L. monocytogenes strains were found to be clustered together with other Listeria species in the phylogenetic tree, including L. welshimeri and L. seeligeri, which were recovered from food processing facility and raw milk having accession codes of KC441000 and DQ065844, respectively. While an apparent diversity was found with some other Listeria species, such as L. thailandensis with accession No. NR-180224, isolated from fried chicken in Thailand (Figure 5).
Figure 5: The phylogenetic analysis of the 16S rRNA gene from the seven Listeria monocytogenes strains isolated from various origins. The phylogenetic tree shows the genetic matches between the stains under investigation and those submitted to the GenBank database.
Discussion
Various diseases and fatalities can be brought on by foodborne microorganisms globally (33). The bacterium Listeria monocytogenes is a significant foodborne organism associated with numerous serious outbreaks; moreover, it may contaminate food items during or after processing. In the present study, L. monocytogenes varied among various sources, with a total incidence of 11.30 and 3.48% using conventional and PCR procedures, respectively. It is possible that the higher incidence rate observed with the conventional method was due to false-positive colonies, as reported by Kim et al. (34).
Various investigations have recorded different incidence rates of L. monocytogenes. Yan et al. (8), Abdollahzadeh et al. (35), Al-Gburi (36), Bouymajane et al. (37), and Elsayed et al. (38) reported prevalence rates of 4.13, 2.95, 6.66, 2.9, and 11.9%, respectively. The variation in incidence rates observed in many investigations might be due to differences in sample sizes, isolation techniques, and geographical locations, as suggested by Diriba et al. (39), which is similar to our opinions.
The environment and equipment used at various processing phases are reliable sources for tracing Listeria contamination in the seafood sector (40). In this study, the highest incidence of L. monocytogenes 8% was identified among fish containers, which agrees with the results of Pedro et al. (41) at 7.20%. However, a lower percentage 1.1% was recorded (31), and a higher percentage also have been recorded 17.1% (42), while Abdollahzadeh et al. (35) could not detect the organism in fish containers. The current study’s highest contamination rate for fish containers could be explained by the tendency of L. monocytogenes to attach and survive on environmental surfaces, especially in insufficient or incomplete cleanliness and sanitation (43). In addition, the formation of biofilms makes Listeria monocytogenes more resistant to antimicrobials and sanitizers (44).
Fish is the main source of animal protein for about 1 billion people, so it has become an essential part of diets globally (45). However, at the same time, it is a potential source of Listeria infection. According to Food Safety News, many researchers have tracked 22 outbreaks of listeriosis between 2010 and 2021 that were probably related to consuming smoked, gravlax, and other fish products. L. monocytogenes tolerance levels are zero for frozen and fresh fish under Egyptian food safety laws (46). In the present investigation, L. monocytogenes was found in the examined fish's 3.48% (4/115), with 6.15% (4/65) detected in fresh fish samples. In contrast, it could not be detected in frozen fish. A similar incidence of fresh fish 6% (47), a higher incidence of 19.3% was also recorded (48). On the other hand, lower percentages were obtained at 0.2% and 4.28% in Turkey (49) and Jordan (50), respectively. Fish can become infected with Listeria in one of two ways: direct contact with polluted water or ingesting bacteria via contaminated feed or sediments. Consequently, the microorganisms detected in fish could be used to infer the health and safety of aquatic habitats (51).
Our study evaluated the presence of Listeria monocytogenes in two globally renowned fish species, tilapia and catfish. Furthermore, these species are popular traditional foods in Egypt and have been previously considered possible sources of Listeria monocytogenes (52). The results showed that the frequency of L. monocytogenes was 5% in tilapia and 8% in catfish. A comparable result was reported by El-Demerdash et al. (53) for tilapia in Egypt 6%. However, a relatively higher isolation rate of 33.3% was recorded in raw Tilapia in Iran by Abdollahzadeh et al. (35). Nevertheless, the absence of Listeria monocytogenes in Nile tilapia samples marketed in Zagazig, Sharkia governorate (54).
Chen et al. (52) in the USA recorded the isolation of L. monocytogenes with high percentages 43.3 and 76.7% in fresh unchilled and chilled catfish fillets, respectively, but could not isolate it from catfish skins and intestines. In contrast, an investigation by Abdallah-Ruiz et al. (43) conducted in the southeastern United States observed a lower percentage 2% of live catfish.
The current findings indicated a higher incidence of L. monocytogenes in catfish than tilapia, possibly because catfish are bottom eaters and pollutants tend to settle in their environment. Moreover, catfish are known for their scavenging behavior and ability to adapt to their surroundings, particularly in polluted water with hypoxia. As a result, they can withstand sewage, making them have greater potential for contamination by pathogenic bacteria like L. monocytogenes.
In this study, L. monocytogenes could not be isolated from frozen fish samples, following the finding of Rahimi et al. (15). Conversely, Tarazi et al. (50) recovered the microorganism in 6.6% of the examined frozen fish samples. These discrepancies in results could be attributed to differences in sampling techniques and analytical methods used. Additionally, various geographic regions and processing facilities may have varying levels of raw fish contamination, which can affect the incidence of Listeria monocytogenes (55).
In the current investigation, the lowest incidence of L. monocytogenes was found in vegetable samples 1.11% using PCR, consistent with the findings of Luchansky et al. (56), who recorded a similar incidence of 1.12%. While Maćkiw et al. (57) reported a lower incidence of 0.56 %. Conversely, Bouymajane et al. (37) failed to find L. monocytogenes in salads in Morocco, while Cordano and Jacquet (58) and Sant'Ana et al. (59) reported higher incidences of 15.3 and 3.1%, respectively.
Of the three types of vegetables investigated in our study, L. monocytogenes was only found in cauliflower at a rate of 3.33%. At the same time, parsley and lettuce were negative for the bacterium. Similarly, Cordano and Jacquet (58) could not recover L. monocytogenes from lettuce or cauliflower. However, Sant'Ana et al. (59) noted a higher prevalence of 2.0% in lettuce. The growth of L. monocytogenes in vegetable samples is affected by several variables, including the food’s intrinsic qualities (such as water activity, NaCl content, pH, and associated microflora) and extrinsic variables (such as gas atmosphere and temperature) Sant'Ana et al. (60). In our research, L. monocytogenes was found only in cauliflower. This finding may be related to the fact that cauliflower grows in fertile, well-drained, and moisture-retentive soil with a pH between 6 and 7, the conditions which facilitate the growth of L. monocytogenes (61).
Concerning human samples, similar occurrence rates of L. monocytogenes were detected in hand swabs of fishermen and diarrheal samples 4 and 4.44%, respectively using PCR. Abbasi et al. (62) reported a closely related incidence of 5.2% in diarrheal samples. However, Meghdadi et al. (63) and Abdelaziz and Mohamed (64) identified increased incidences of 7.5% and 12.5%, respectively. Ahmed et al. (54) documented a lower percentage 2% of L. monocytogenes in diarrheal samples, while Cheun et al. (65) was unable to isolate L. monocytogenes from human diarrheal samples. Our findings confirm that human wastes play a role in transmitting zoonotic pathogens (66). Fallah et al. (42) and Jamali et al. (13) identified variable incidences of L. monocytogenes in hand swabs from fishermen, with rates of 16.2% and 2.1%, respectively. Conversely, Akkaya et al. (67) could not isolate L. monocytogenes from the hand swabs of fishermen. Differences in the sensitivity of the enrichment, diagnostic, and culture procedures employed to identify the existence of L. monocytogenes may explain the variations in patient samples between our study and those reported in other studies. Variations in nutrition, resistance to L. monocytogenes infection, and level of exposure to environmental L. monocytogenes bacteria reservoirs may also exist (68). A retrospective study in Finland (69) revealed the risks of consuming seafood contaminated with L. monocytogenes. According to a Finland study, a strain of L. monocytogenes detected in multiple sporadic cases of listeriosis was identical to an epidemic strain from fish.
Regarding age, two of the four L. monocytogenes strains 5.71% recovered from diarrheal samples were detected in individuals aged 5-17 years in our study, followed by one isolate each in the 31-43 (5.26%) and 18-30 (3.70%) year age groups. In research by Abbasi et al. (62), most L. monocytogenes infections 77.7% were noted in children under five.
In the present investigation, all patients with L. monocytogenes infections were females, while male patients did not have the infection. In an Iranian study by Abbasi et al. (62), male patients made up 55.5% of the L. monocytogenes infection patients, while female patients made up 44.4%. In Sweden, male patients comprised 47.9% of cases, while female patients comprised 52% (70). Females are more prone to contracting L. monocytogenes because they handle fish, which serves as a vehicle for L. monocytogenes. Moreover, they handle rabbits and poultry, such as fowl, turkeys, ducks, geese, pigeons, and others, which are sources of infection.
Regarding the residence risk factor, the incidence of L. monocytogenes in urban areas 4.76% was greater than in rural areas 3.70%. As the level of human activity and L. monocytogenes prevalence are correlated (51), the higher incidence in urban areas could be attributed to the higher population density and associated human activities. As well as food habits, people in urban areas usually eat ready-to-eat food from fish restaurants.
Although L. monocytogenes is not the main source of foodborne illness, it has the greatest rate of fatalities due to certain virulence characteristics (71). In our research, the occurrence of the inlA gene, which is a bacterial surface protein for host cell attachment (72), was 100% in all L. monocytogenes strains noticed in fish, fish containers, vegetables, and human samples. The present findings are consistent with prior investigations in which L. monocytogenes samples were recovered from diverse sources, such as fish (49), fish containers (13), vegetables (57), and humans (63), and were found to harbor the inlA gene. However, Abdelaziz and Mohamed detected a comparatively lower prevalence 33.3% of the gene in human isolates (64).
LLO, a pore-forming surface toxin produced by the hemolysin A (hlyA) gene, is necessary to lysis vacuole membranes and release L. monocytogenes into the cytoplasm (73). The overall incidence of this gene was 41.67%, distributed as follows: fish 50%, fish containers 50%, vegetables 100%, and humans 20%. While Jamali et al. (13) and Bouymajane et al. (37) detected the hlyA virulence-associated gene in all L. monocytogenes isolates in fish and both fish containers and humans, respectively, the same result in vegetables 100% was obtained by Soni et al. (74).
The emergence of antibiotic resistance is a further hazard to L. monocytogenes infections. This study discovered that ampicillin had the highest resistance rate 100%, followed by gentamicin 50%. Elsayed et al. (38) reported a resistance rate of 97.3% to ampicillin, which is close to our findings. Jamali et al. (13) reported a lower resistance rate 27.9% to ampicillin than our finding. On the other hand, Kuan et al. (75) indicated that their study detected no resistance to ampicillin. The frequent use of this antibiotic to treat infections in individuals and animals may account for the study’s high resistance rate to ampicillin.
The appearance of gentamicin-resistant L. monocytogenes is becoming increasingly evident, as has been observed by our research and other investigators (76). In our study, all L. monocytogenes isolates noticed in human diarrheal samples were resistant to gentamicin, which might be attributed to the overuse of aminoglycosides in human medicine. Meanwhile, the highest sensitivity levels in this study were recorded for enrofloxacin 100%, amoxicillin-clavulanic acid 91.67%, chloramphenicol 91.67%, and tetracycline 75%. Moreover, Lotfollahi et al. (77) and Çokal et al. (78) mentioned that L. monocytogenes isolates had complete sensitivity 100% for amoxicillin-clavulanic acid, tetracycline, and chloramphenicol, respectively. In contrast, Akrami-Mohajeri et al. (79) indicated no sensitivities were detected to tetracycline, chloramphenicol, or amoxicillin/clavulanic acid.
In addition, 25% of L. monocytogenes recovered isolates showed multidrug resistance. This is a significant public health issue since it might make treating listeriosis more difficult. While the lower occurrence obtained by Garedew et al. (47) was 16.7%, in contrast, Akrami-Mohajeri et al. (79) and Elsayed et al. (80) mentioned that all their L. monocytogenes strains exhibited multidrug-resistant.
The current data show that the MAR index for L. monocytogenes isolates ranged from 0.125 to 0.625. Badawy et al. (81) observed a greater MAR index 0.33 to 0.88 for L. monocytogenes identified in dairy cattle, the environment, and dried milk in Egypt. In contrast, lower MAR indices 0.07 to 0.50 were detected in milking equipment, raw milk, and dairy workers by Tahoun et al. (76), and 0.17- 0.42 were detected in animals, humans, and animal feed by Elsayed et al. (38), respectively.
In the current research, MAR indices higher than 0.2 were present in 75% of L. monocytogenes isolates, with the most significant MAR index 0.625 detected in the L. monocytogenes isolate noted in a human diarrheal swab, indicating a high-risk source of contamination in which antibiotics were overused (81). In contrast, MAR indices of less than 0.2 were present in only 25% of isolates, indicating that these isolates came from a location where antibiotics are not commonly employed (82).
Because food-borne L. monocytogenes strains are becoming increasingly antibiotic-resistant, future outbreaks may be challenging to control (83). Additionally, no commercially available vaccination is available to protect against listeriosis (84).
The primary source of phylogenetic data for microorganisms, 16S rRNAs (a recognizable marker for a bacterial species), are currently used for microbial characterization and classification. Further, numerous studies have demonstrated the important role of 16S rRNA in the identification, differentiation, genetic relatedness, and phylogenetic analysis of L. monocytogenes from various environmental, clinical, and dietary samples (85). When investigating different sources and geographical areas, all Listeria 16S rRNA gene sequences were similar to prior sequences added to the GeneBank database. The seven bacterial isolates have a single common ancestor, as shown by the phylogenetic tree, which clarifies the imperative role that fish and vegetables play in transmitting human listeriosis. Nearly similar results were recorded by Soni et al. (74), and Abdeen et al. (86), both revealed great similarity (more than 99% nucleotide match). In the 16S rRNA gene sequences, we did not find any recent mutations which support the gene's slow evolution.
Conclusion
Vegetables and fish are a primary cause of L. monocytogenes infections in people, which has major global health implications. The severity of this disease has been compounded by widespread antimicrobial resistance, which increases the probability that treatment may fail by using available medications. Consequently, we urge all national health organizations to adopt stricter measures to prevent this resistant pathogen from developing.
Acknowledgments
The authors are thankful to Dr. Wail Ali Fawaz, Molecular Biology Researches & Studies Institute, Assiut University for assisting us in the molecular technique.
Conflict of interest
The authors affirm that they do not have any conflicts of interest.