Introduction
The AMP-activated protein kinase (AMPK) pathway is a highly conserved signaling pathway crucial in maintaining cellular energy homeostasis in eukaryotic cells. This pathway is activated in response to decreased cellular energy levels, such as during exercise, fasting, or glucose deprivation. Once activated, AMPK promotes the production of ATP, the primary energy source for cells, while inhibiting energy-consuming processes, such as protein and fatty acid synthesis. Thus, AMPK is a central regulator of cellular energy metabolism, ensuring that cells have enough energy to perform their necessary functions (1,2). Atherosclerosis is a chronic and complex inflammatory disease affecting the arteries and is considered one of the leading causes of cardiovascular diseases. This disease is characterized by the accumulation of lipids, immune cells, and other substances in the inner lining of the arteries, which leads to the formation of plaques. These plaques cause the arteries to narrow and restrict blood flow, leading to serious consequences such as heart attacks, strokes, and other cardiovascular complications (3). AMPK activation has been shown to have anti-atherogenic effects through several mechanisms, including inhibiting lipid synthesis and promoting cholesterol efflux from macrophages (4). Additionally, AMPK activation can suppress the production of pro-inflammatory cytokines and chemokines by immune cells, thereby reducing the recruitment of inflammatory cells to the arterial wall (2,5). Moreover, AMPK activation can enhance endothelial cell function and promote angiogenesis, which can help to restore blood flow to ischemic tissues (6). Several plant products are modulating AMPK activators (7-9) and have been shown to have beneficial effects on atherosclerosis in preclinical and clinical studies. However, the precise mechanisms underlying these effects are still not fully understood, and further research is needed to elucidate the role of AMPK signaling in atherosclerosis and to develop new therapeutic strategies targeting this pathway. In summary, the AMPK pathway is a promising target for the prevention and treatment of atherosclerosis, and further studies are needed to fully exploit its potential benefit in this disease (10). Researchers conducted studies to identify the therapeutic roles of nanoparticles in different diseases status (11-14).
Therefore, in the present study, we explored the role of silver nanoparticles on the modulation of atherosclerosis in certain aspects using a well-known antiatherosclerotic costus plant as a loading plant
Materials and methods
Ethical approve
The scientific committee has approved this study of the college of veterinary medicine- University of Baghdad at the seventh congress dated 11/1/2022, that the concurrent conducting experiment did not violent the laws of animal rights and the euthanasia is applied in accordance of this guidelines, and approval issue number and date is UM.VET.2022.014.
Costus extract and nanoparticle formulation
The utilization of plants to create silver nanoparticles is more advantageous than using other biological processes, and every year, more publications (about 468 in 2020) report using plant extracts in the production of nanoparticles were reported. Green-produced nanoparticles with antioxidant and cytotoxic capabilities may be viable for advancing nanomaterials due to the economic benefits of employing plants in biosynthesis and the lack of need for hazardous chemicals or processes. In the present study, Costus has been used due to its common therapeutic potential.
Effective dose determination
The effective dose after 14 days of treatment with Sassurea costus loaded AgNPs (Figure 1).
Figure 1: Reveals the effect of successive doses of AgMSNPs on the atherogenic index after 14 days in adult rats.
The experimental animal models
36 male Albino rats age 4 weeks; weight 200-250g were for this experimental trial. The rats were kindly provided by the animal house/College of Veterinary Medicine/University of Mosul and were fed a standard commercial meal and housed at a stable temperature of 22-25ºC. Before the trial, the rats were acclimated for 7 days and split into four groups, each consisting of five rats. Group 1: The control group was treated with distal water orally for 12 days. Group 2: Control positive treated with H2O2 (1%) +cholesterol. Group 3: Control positive treated with H2O2 (1%)+cholesterol+costus. Group 4: Control positive treated with H2O2 (1%) +cholesterol+ costus loaded silver nanoparticles.
Blood sampling
Blood samples were taken from rats after 14 days of experimentation. A capillary tube was implanted in the inner corner of the eyeball to draw blood from the eye vein. The blood was placed in gel tubes, clotted, and separated using a centrifuge. The serum was stored in the refrigerator for further analysis. Ethylene diamine tetra acetic acid (EDTA) was used to take blood samples for manual hematological analysis. The Leishman stain was used for blood smear staining to analyze physiological parameters. The serum was used for biochemical analysis, including ApoA1, oxLDL, SAA, Visfatin, and LDH measurement.
Preparation of Silver Nanoparticle: a 1 mM AgNO3 solution was prepared by dissolving 4.56 gms of silver nitrate in 200 ml of deionized distilled water. The solution was mixed with an ultrasonic water bath for 20 minutes and placed in a dark place to avoid auto-oxidation. The study involved modifying a method for preparing silver nanoparticles using vitamin C as a reducing and capping agent. The mixture is left for an hour and monitored for a color change indicating the formation of silver nanoparticles. The residue is washed and dried before being stored in dark bottles at 4 ˚C. Different methods characterize AgNPs, including UV-visible spectrometry, FT-IR, XRD, SEM, AFM, and EDS.
Collection of plant
In February 2021, roots of Sassurea costs were collected from an Indian province and were identified and verified by a taxonomist in Baghdad's Directorate of Seed Testing and Certification. The plant was classified as a Saussurea species and belongs to the Asteraceae family.
Extraction of plant
The process of extracting plant material using methanol as a solvent. The ground plant material was air-dried and extracted using the Soxhlet method with 80% v/v methanol: water for 8 hours. The resulting extracts were concentrated, dried, and stored in a refrigerator until further use (15).
Characterization of AgNPs
Various methods assessed the biosynthesized silver nanoparticles, including visual color changes, UV-visible spectrometry, FT-IR, XRD, SEM, AFM, and EDS. The UV-visible spectroscopy method is important for evaluating and determining the synthesized AgNPs in an alcohol solution. The Shimadzu UV-1600 in the Ministry of Science and Technology labs was used for this purpose. A brown color shift in the reaction was observed due to the Plasmon resonance peak for the silver nanoparticles. The peak was located between 450 and 550 nm. The strong band in the spectral pattern is caused by the stimulation of localized surface plasmons, which causes intense light scattering by an electric field at a wavelength where resonance occurs.
The text explains using X-Ray Diffraction (XRD) to analyze phase identification and crystallization of nanoparticles, particularly Sassurea costus AgNPs particles. XRD provides information on particles' metallic nature, size, shape, and electron density. It works by diffracting light at various angles when an X-ray passes through a crystal, creating a diffraction pattern that reveals the atomic arrangement inside the crystal. The silver nanoparticles were analyzed using XRD in the Ministry of Research and Technology labs with a 6000/Shimadzu instrument from Japan.
The scanning electron microscope (SEM) records secondary electrons emitted from the sample by the electron beam impinging on it, providing three-dimensional morphology of objects. The electron beam is concentrated to small points by magnetic lenses and driven back and forth over the object by scanning coils. This examination was done at the Ministry of Science and Technology labs using Tescan Vega I/Czech SEM to analyze the morphology of samples. To analyze Sassurea costus AgNPs, a drop is placed on a clean slide, and the water is allowed to fully evaporate.
The article describes using an atomic force microscope (AFM) to examine the topography of a material. The AFM uses a nano-sized tip connected to a cantilever to generate a 3D picture of the sample topography. The AFM is preferred over the SEM for detecting and examining the size and shape of silver nanoparticles in three dimensions and is used to determine their height.
EDS (Energy Dispersive Spectroscopy) was used to determine the elemental composition of a reaction mixture using the INCA Energy 250 system from Oxford, Japan.
Effective dose determination
The experiment aimed to determine the effective dosage of Sassurea costus AgNPs on various parameters in adult male rats. 30 rats were randomly assigned to six groups, with one group as a control, and the others were given different doses of Sassurea costus AgNPs orally for 14 days. The rats were monitored for toxicity and death, and blood samples were analyzed before euthanizing. The analysis included lipid profile, hematological analysis, atherogenic index, and biochemical and physiological parameters using Leishman stain on blood smear staining.
Genetic analysis
The text uses two primers, one for the B-actinin gene and another for the AMPK gene (Table 1), to measure gene expression through qRT-PCR methods. The primers were created using data from NCBI-Gene Bank and Primer 3 online and were assisted by Bioneer in using Ethidium bromide DNA binding dye.
Table 1: Forward and reverse of designed primers
|
Primers
|
Sequence
|
Primer sequence
|
Tm(ᵒC)
|
GC (%)
|
|
AMPK
|
F
|
GACCTGAAGCCAGAGAACGTG
|
63.3
|
57
|
|
R
|
AGCCTTCCTGAGATGACCTCC
|
64.8
|
57
|
|
B actin
|
F
|
GAGGGAAATCGTGCGTGACAT
|
62.2
|
52
|
|
R
|
AACCGCTCATTGCCGATAGTG
|
61.5
|
52
|
The Synthesis SuperMix for qPCR is an incredibly useful kit for researchers looking to synthesize cDNA from total RNA or mRNA. The kit contains all the necessary components, allowing researchers to perform simultaneous genomic DNA removal and cDNA synthesis. The resulting cDNA is suitable for qPCR but not for regular PCR. This is because standard PCR requires longer DNA fragments than qPCR, which targets smaller fragments. The kit is provided at a concentration of 5× and is used at a concentration of 1× by adding gDNA remover, RNA, and H2O. This makes it incredibly easy to use, as researchers don't need to worry about measuring out different components or worrying about what they might be missing. The kit also includes a gDNA remover, which helps to remove any genomic DNA that might be present in the sample. This is important because genomic DNA can interfere with qPCR results, leading to inaccurate readings. After the cDNA synthesis, the gDNA remover and reverse transcriptase are inactivated by heating at 85ºC for 5 seconds. This step is crucial in ensuring that the cDNA is suitable for qPCR and that any remaining reverse transcriptase or gDNA remover won't interfere with the qPCR results. Overall, the Synthesis SuperMix for qPCR is an incredibly useful tool for researchers looking to synthesize cDNA from total RNA or mRNA. It simplifies the process by providing all the necessary components and allows researchers to perform simultaneous genomic DNA removal and cDNA synthesis. The resulting cDNA is suitable for qPCR and is easy to use, making it an essential kit for any researcher working with qPCR.
The EasyScript First-Strand cDNA Synthesis SuperMix kit contains all the necessary components for cDNA synthesis from total RNA or mRNA. It includes the EasyScript RT/RI Enzyme Mix and 2×ES Reaction Mix, which efficiently synthesize cDNA. The kit also has deficient Rase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. The product obtained from 15 minutes reaction is used for qPCR, while the product obtained from 30 minutes reaction is used for PCR. The kit includes an Anchored Oligo(dT) Primer that binds to the first base next to mRNA Poly(A)* on the 5' end with high specificity, ensuring high efficiency and success rate of first-strand cDNA synthesis.
The procedure for performing Quantitative RT-PCR using the GoTaq® qPCR Master Mix kit contains primers, cDNA samples, and water. The B actin gene is used as the endogenous control, and the qPCR is conducted at 95°C for 1 minute, followed by 45 cycles of denaturation and annealing. Finally, melting curve analysis is performed based on the characteristics of double-stranded cDNA during cycles. The text describes a method for determining the expression of target genes using the comparative Ct formula and Folding =2^-ΔΔCT analysis. The Ct value of the target genes is standardized to the B actin reference gene. The reaction is mixed, centrifuged, and stored on ice before being placed in a thermal cycler that is programmed accordingly.
Measurement of visfatin, ApoA1, oxLDL, and SAA
The ELISA kits for measurement of visfatin, ApoA1, oxLDL, and SAA (Elabscience, USA) use the Sandwich-ELISA principle to detect Rat visfatin, ApoA1, oxLDL, and SAA concentration. A micro-ELISA plate is pre-coated with an antibody specific to Rat visfatin, ApoA1, oxLDL, and SAA. The process for measuring the concentration of Rat VF in samples using a biotinylated detection antibody and Avidin-HRP conjugate. The process involves measuring the OD value spectrophotometrically at 450 nm ± 2 nm and comparing it to a standard curve. Additionally, the text mentions that LDH can detect cell damage or cell death.
Results
Visual observation or color modification of biosynthesized silver nanoparticle (AgNPs)
The initial stage in the fabrication of biogenic AgNPs utilizing alcohol extract to ensure costus is to adjust the particle color (AgNPs). When the Sassurea costus extract was added to the colorless silver nitrate solution (Figure 2), the color of the combination changed to brownish after 20 minutes. The color began to alter from white Transparent to dark lead of silver nanoparticles after 48 hours.
Figure 2: Explain the Color change during the formation of Silver Nanoparticles: A-AgNO3 only. B-Chang in color from brown to silver when put the mint extract drop by drop. C-Chang the color after 2 hours from reaction time. D-Depositions of particles (centrifuge and wash). E-The AgNPs after two days.
UV-Visible spectroscopy Ag nanoparticles
The optical absorbance of manufactured AgNPs was evaluated by (UV-Vis) spectroscopy. The existence of AgNPs is confirmed by an absorbance peak 215 nm (Table 2).
Table 2: UV-VIS peak values of extract of AgNPS, Sassurea costus, and AgNPs Sassurea costus
|
No
|
Wavelength
|
Abs
|
|
AgNPs
|
215
|
3.436
|
|
AgNPs Sassurea costus
|
224
|
3.524
|
|
Sassurea costus
|
271
|
0.509
|
FT-IR spectrum of alcohol roots extract of AgNPs Sassurea costus: FT-IR analysis was carried out to identify major functional groups present at different positions in the root extract of Sassurea costs. The obtained peaks in the FT-IR spectrum of silver were compared for best matches with libraries of spectra cataloged for available material (Figure 3).
Figure 3: FT-IR spectrum of Biogenic AgNPs.
X-Ray diffraction (XRD)
The XRD pattern is an important tool used in material science to describe the crystalline nature of a substance. In figure 4, the XRD pattern describes the biosynthesized silver nanoparticles (AgNPs), which occur due to metal ions (Ag+) reduction by the bioactive compounds present in a plant extract. This process is of great interest to researchers because it provides a sustainable and green approach to synthesizing silver nanoparticles, widely used in various fields such as medicine, electronics, and environmental science. The XRD pattern shows the diffraction peaks of the AgNPs, which are characteristic of their crystalline structure. The equation used to describe the process of biosynthesis provides a quantitative understanding of the process and helps researchers to optimize the conditions for the synthesis of AgNPs. The biosynthesis of AgNPs using plant extracts is a promising area of research that has the potential to replace conventional methods that use toxic chemicals. The XRD pattern and the equation used to describe the process provide valuable information that can be used to improve the synthesis of AgNPs and make them more sustainable and environmentally friendly.
Figure 4: The XRD pattern of biosynthesized AgNPs
Scanning electron microscopy (SEM) analysis for AgNPs
The image SEM, or Scanning Electron Microscope, is a powerful tool that allows us to see the intricate details of the biosynthesized silver nanoparticles using S. costus root extracts. Figure 5 reveals that the nanoparticles are small and highly aggregated, with some larger nanoparticles associated with a spherical shape. This suggests that the aggregation process may have influenced the final shape of the nanoparticles. In addition, the image shows that some particles were scattered. In contrast, others were mixed, indicating that the time after synthesis may have played a role in the final distribution of the nanoparticles. Overall, the SEM image provides valuable insight into the structure and characteristics of the biosynthesized silver nanoparticles, which can help researchers better understand their properties and potential applications. By utilizing advanced imaging techniques like SEM, we can continue to push the boundaries of scientific discovery and innovation.
Figure 5: Scanning Electron Microscope image for Biogenic AgNPs
Atomic force microscopy (AFM) of Sassurea costus AgNPs
The size and colloidal stability of nanoparticles are crucial factors that determine their properties and applications. In this context, the extract used in the synthesis of nanoparticles plays a big role. The extract helps control nanoparticle size, shape, and stability. The study found that alcohol AgNPs had a thin, flat shape with a thickness between 0.5 and 2.7 nm (Figure 6). This finding is significant because it indicates that the extract used in the synthesis of alcohol AgNPs has a strong influence on their morphology and physical properties. The AFM analysis of the surface topography further confirmed the thin and flat shape of alcohol AgNPs. This information is useful for researchers and engineers interested in developing new nanoparticle applications. By understanding the extract's role in controlling the size and shape of nanoparticles, researchers can design more efficient and effective methods for synthesizing nanoparticles with specific properties and characteristics. Overall, the study provides valuable insights into the synthesis and characterization of nanoparticles, which can help advance the nanotechnology field.
Figure 6: Atomic force microscopy (AFM) for silver nanoparticles was synthesized by alcohol extract of S. costus. (AgNPs) Two-dimensional image (a), three-dimensional image (b), Size Range of Biogenic Silver Nanoparticles (c), and (d).
Energy dispersive spectroscopy (EDS) analysis of Sassurea costus AgNPs
Energy dispersive spectroscopy (EDX) of the spectrum reveals a strong signal in the silver region and confirms the formation of AgNPs (Figure 7).
Figure 7: Energy dispersive spectroscopy (EDS) analysis of Sassurea costus AgNPs
Induction of atherosclerosis
The induction of atherosclerosis (G2, G3, and G4) has shown a statistically significant increase in plasma concentrations of ApoA1 compared to the negative control group. However, ApoA1 was elevated alongside using the diet with cholesterol alone (G3) and cholesterol+ H2O2 (G4), compared to the H2O2 alone (G2) group. Moreover, a combination of cholesterol+ H2O2 (G4) has significantly elevated ApoA1 than using either alone. The induction of atherosclerosis (G2, G3, and G4) has demonstrated a significant elevation of plasma concentrations of oxLDL compared to the negative control group. However, oxLDL was elevated alongside using the diet with cholesterol alone (G3) and cholesterol+ H2O2 (G4), compared to the H2O2 alone (G2) group. Moreover, a combination of cholesterol+ H2O2 (G4) has significantly elevated oxLDL than using either alone. The induction of atherosclerosis (G2, G3, and G4) has shown significantly higher plasma concentrations of SAA compared to the control group. However, SAA was elevated alongside using the diet with cholesterol alone (G3) and cholesterol+ H2O2 (G4), compared to the H2O2 alone (G2) group. The induction of atherosclerosis (G2, G3, and G4) has shown a significant increase in plasma concentrations of visfatin compared to the control group. However, visfatin was elevated alongside using the diet with cholesterol alone (G3) and cholesterol+ H2O2 (G4), compared to the H2O2 alone (G2) group. Moreover, a combination of cholesterol+ H2O2 (G4) has significantly elevated visfatin than using either alone. The induction of atherosclerosis (G2, G3, and G4) has shown significantly higher plasma LDH concentrations than the control group. However, LDH was elevated alongside using the diet with cholesterol alone (G3) and cholesterol+ H2O2 (G4), compared to the H2O2 alone (G2) group. Moreover, a combination of cholesterol+ H2O2 (G4) has significantly elevated LDH than using either alone (Figure 8).
Figure 8: Blood biomarkers in atherosclerosis induced model of the studied group. Data expressed as mean±SD, abcd p<0.05. ApoA1=apolipoprotein, oxLDL=oxidized low-density lipoprotein, SAA=Serum amyloid A, LDH=lactate dehydrogenase enzyme.
Nanoparticle treatment of atherosclerotic model
The ApoA1 has significantly elevated in the H2O2+cholesterol (G2) group, costus-treated group (G3), and costus-loaded nanoparticles (G4) compared to G1 (control) group. H2O2+cholesterol (G2) group has a significantly higher ApoA1 compared to the control group, costus-treated group (G3), and costus-loaded nanoparticles (G4). Weak differences existed between ApoA1 levels of the costus-treated group (G3) and costus-loaded nanoparticles (G4). The SAA has significantly elevated in the H2O2+cholesterol (G2) group, costus-treated group (G3), and costus-loaded nanoparticles (G4) compared to G1 (control) group. H2O2+cholesterol (G2) group has a significantly higher SAA compared to the control group, costus-treated group (G3), and costus-loaded nanoparticles (G4). No differences existed between SAA levels of the costus-treated group (G3) and costus-loaded nanoparticles (G4). The ox-LDL has significantly elevated in the H2O2+cholesterol (G2) group, costus-treated group (G3), and costus-loaded nanoparticles (G4) compared to G1 (control) group. H2O2+cholesterol (G2) group has a significantly higher oxLDL compared to the control group, costus-treated group (G3), and costus-loaded nanoparticles (G4). Weak differences existed between oxLDL levels of the costus-treated group (G3) and costus-loaded nanoparticles (G4). The visfatin has significantly elevated in the H2O2+cholesterol (G2) group compared to G1 (control) group. Costus-treated group (G3) and costus-loaded nanoparticles (G4) have significantly reduced LDH compared to H2O2+cholesterol (G2) group. No differences existed between visfatin levels of the costus-treated group (G3), costus-loaded nanoparticles (G4), and control group. The LDH has significantly elevated in the H2O2+cholesterol (G2) group compared to G1 (control) group. Costus-treated group (G3) and costus-loaded nanoparticles (G4) have significantly reduced LDH compared to H2O2+cholesterol (G2) group. No differences existed between LDH levels of the costus-treated group (G3), costus-loaded nanoparticles (G4), and control group (Figure 9).
Figure 9: Silver nanoparticles have improved the measured parameters linked to atherosclerotic diseases. ApoA1=apolipoprotein, oxLDL=oxidized low-density lipoprotein, SAA=Serum amyloid A, LDH=lactate dehydrogenase, G1=Control, G2= H2O2+cholesterol, G3=extract plant, G4=plant loaded with nanoparticles.
Gene expression profile and subsequent suppression by costus-loaded nanoparticles
The AMPK gene expression has been calculated as a fold of changes concerning the housekeeping gene; the outcome revealed that AMPK gene expression is higher in the cholesterol+ H2O2 (G2) group compared to the control (G2) group, costus-treated group (G3), and costus-loaded nanoparticles (G4). The study has confirmed that the costus-treated group (G3) and costus-loaded nanoparticles (G4) have significantly reduced AMPK gene expression (Table 3).
Table 3: AMPK gene expression induced by costus-loaded nanoparticles compared to costus alone, positive, and negative groups fold of changes relative to a housekeeping gene.
|
Group
|
AMPK gene
|
|
Control
|
1.617 ± 0.496 B
|
|
H2O2+cholesterol
|
2.265 ± 0.443 A
|
|
Extract plant
|
1.390 ± 0.148 C
|
|
Plant loaded with nanoparticles
|
1.120 ± 0.526 D
|
Discussion
Nanoparticles have become increasingly popular in various fields, including medicine, energy, and electronics. However, recent research has shown that their impact on human health is still largely unknown. One area of concern is the potential impact of nanoparticles on cardiovascular health (16). Studies have found that nanoparticles can reduce the production of Apolipoprotein A, which plays a critical role in maintaining healthy cholesterol levels (17). This reduction in production could lead to a buildup of cholesterol in the bloodstream, which increases the risk of heart disease. One possible explanation for the effect of nanoparticles on Apolipoprotein A is that they interfere with the liver's normal function (18). The liver produces Apolipoprotein A, and nanoparticles may disrupt this process, leading to decreased production. Another possibility is that nanoparticles could bind to Apolipoprotein A, preventing it from performing normal bodily functions (19). The impact of nanoparticles on human health is still largely unknown, and while some studies have suggested negative health effects, others have found no significant impact (20). This uncertainty highlights the need for caution when considering the use of nanoparticles in various applications. It is important to carefully consider nanoparticles' potential risks and benefits, particularly regarding human health. As researchers continue to study the potential impact of nanoparticles on human health, the goal should be to develop safe and effective ways to use these particles in various applications. This will require ongoing research and careful consideration of nanoparticles' potential risks and benefits. Ultimately, the goal should be to maximize the benefits of nanoparticles while minimizing any potential negative impacts on human health (21). The AgNPs Sassurea costus product was characterized by UV-Visible spectroscopy, AFM, EDS, FTIR, XRD, and SEM to confirm the model's specification. These techniques have been used, and the outcome has confirmed that the formulated product's characteristic features are within the normally required ranges.
Plant extracts containing active constituents such as flavonoids and anthocyanins have been gaining attention in recent years for their potential benefits in reducing amyloid protein. Studies conducted by Ochiishi et al. (22) have reported that these plant extracts have shown promise in reducing amyloid protein levels in vitro cell culture models. Similarly, plant extracts have shown efficacy in suppressing amyloid in cell lines (23). Moreover, Chen et al. (24) reported that several herbal products commonly used in Chinese medicine have demonstrated significant changes in amyloid protein expression. In addition to plant extracts, gold nanoparticles have also been effective in modulating amyloid levels. Moore et al. (25) reported that nanoparticles induce changes in the structural protein and concentration of amyloid. Cabaleiro-Lago et al. (26) also found that nanoparticles induce changes congruent with these results.
Furthermore, studies conducted by Chakraborty et al. (27) have reported that the levels of SAA have been reduced, thus reducing amyloid toxicity in Alzheimer’s disease, tuberculosis, leprosy, and cancer (27). This action has been supported by alternative studies (28,29). Various studies have shown that plant extracts containing active constituents, gold nanoparticles, and SAA have demonstrated potential benefits in reducing amyloid protein levels. These findings suggest that further research is needed to explore the potential therapeutic benefits of these compounds and their effectiveness in treating amyloid-related diseases such as Alzheimer’s, tuberculosis, leprosy, and cancer.
Recent research has found that certain types of nanoparticles can reduce ox-LDL levels in the body. oxLDL is a harmful form of LDL cholesterol that contributes to the development of atherosclerosis, a condition in which plaque builds up in the arteries and can lead to heart attack or stroke (30). This research has shown that silver nanoparticles reduced ox-LDL levels in human blood serum. In contrast, iron oxide nanoparticles reduced the levels of oxLDL in the blood of rats (31). The exact mechanism by which nanoparticles reduce oxLDL is still not fully understood. Still, it is thought to involve a combination of physical and chemical interactions between the nanoparticles and the ox-LDL particles (32). It has been suggested that the nanoparticles may bind to the oxLDL and prevent it from binding to receptors on the surface of cells, or they may break down the oxLDL particles into smaller, less harmful components. The potential implications of this research are significant. If nanoparticles can be used to reduce ox-LDL levels in the body, they could potentially be used to prevent or treat atherosclerosis and other cardiovascular diseases (33). However, there are also potential risks associated with the use of nanoparticles that need to be carefully considered. Toxicity and environmental impacts are among the risks that must be considered (34). Despite the potential risks, the findings from this research are promising and warrant further investigation. If nanoparticles can be used to reduce ox-LDL levels in the body, they could potentially revolutionize the treatment of cardiovascular diseases. More research is needed to fully understand the mechanisms involved and to determine the potential risks associated with the use of nanoparticles. However, this research represents an exciting area of study that has the potential to improve human health significantly.
Visfatin is a protein hormone secreted by adipose tissue and plays a crucial role in regulating glucose metabolism and insulin sensitivity. High visfatin levels are associated with obesity, type 2 diabetes, and other metabolic disorders. Recently, scientists have discovered that silver nanoparticles have the potential to effectively reduce visfatin levels in human adipocyte cells. Researchers synthesized silver nanoparticles and tested their ability to inhibit visfatin expression in human adipocyte cells (35,36). The results showed that the silver nanoparticles significantly reduced visfatin expression at both the mRNA and protein levels (37).
Additionally, the researchers found that the silver nanoparticles had no significant cytotoxic effects on the human adipocyte cells, indicating that they were safe to use (38). While the mechanism by which silver nanoparticles reduce visfatin levels is not yet fully understood, it is believed that the nanoparticles may interfere with the signaling pathways that regulate visfatin expression (37). However, further research is needed to fully understand their mechanism of action and potential side effects. It is important to note that the use of nanoparticles in medicine is still a relatively new field, and their long-term effects on human health are not yet fully understood. Despite the promising results of this study, it is crucial to exercise caution when considering using silver nanoparticles to reduce visfatin levels. While they appear safe for human adipocyte cells, their effects on other cell types and tissues have not been fully explored. Additionally, using nanoparticles in medicine raises concerns about their potential toxicity and environmental impact. Therefore, it is essential to conduct further research to fully understand the benefits and risks associated with using silver nanoparticles in medical applications (37).
Aposomes are increasingly being recognized as modern nanotechnology with diverse applications in medicine. In a recent study conducted by Boada et al. (17), the impact of aposomes on the level of LDH in a mice model was investigated. LDH, which stands for lactate dehydrogenase, is a key biomarker used to assess the level of tissue damage (17). The study revealed no changes in the level of LDH in the plasma, tissue, or cellular samples of the mice model, indicating that aposomes did not cause significant tissue damage. This is an encouraging finding as it suggests that aposomes could be used as safe and effective nanotechnology in medical treatments.
In contrast, curcumin nanoparticles have been reported to decrease LDH expression in heart tissue, providing protection against tissue damage (39). Curcumin is a natural polyphenol found in turmeric and has been shown to have anti-inflammatory and antioxidant properties. Using curcumin nanoparticles could therefore be a promising strategy for protecting against heart disease and other conditions associated with tissue damage. Overall, these findings highlight the potential of nanotechnology in medical treatments. While aposomes may not directly impact LDH expression, they still hold promise for a range of applications. As research advances, we may see even more innovative uses for nanotechnology in the medical field (40).
Using plant extracts for medicinal purposes has long been a subject of interest for researchers. In particular, recent studies have focused on the ability of certain plant extracts to block or reduce AMPK expression. One such study, conducted by Ko et al. in 2020, found that artesunate extracted from the Chinese herb sweet wormwood significantly reduced the expression of chain genes involved in lipid metabolism (41,42). This finding was consistent with other research, such as that conducted by Wu et al. in 2018, which showed that activating AMPK-linked genes by polyphenols led to reduced atherosclerotic lesions (43). Sung et al. also found that medicinal plants like Phyllostachys pubescent and Scutellaria baicalensis can activate AMPK, resulting in lipolysis and reduced lipid concentration (44).
Additionally, Zhang et al. (45) discovered that Costus can reduce lipid anabolism and induce catabolism by a similar mechanism to these plants via reducing AMPK. Polystyrene nanoparticles loaded on Daphnia pulex have also been found to reduce plasma lipid via activation of the AMPK pathway, as demonstrated by Changan and Xiaojie (46). Furthermore, Acosta et al. have developed dry powdered inhalers with inhalable nanoparticles/microparticles of an AMPK and Nrf2 activator for directed pulmonary delivery of drugs (47,48). Finally, Wang et al. (2) found that activation of AMPK can reduce atheromatous macrophage inflammatory reaction. These studies provide valuable insights into the potential uses of plant extracts in treating various health conditions.
AMPK activation is a topic that has been studied concerning its effects on vascular tissues, and it is believed to contribute to some of the positive effects of statins on the cardiovascular system. However, it is important to note that not all these effects can be attributed to AMPK activation alone. In addition to its effects on the cardiovascular system, AMPK activation has also been shown to inhibit HMG-CoA reductase activity, which can reduce cholesterol levels. This is significant because high cholesterol levels are a major risk factor for the development of atherosclerosis, a condition in which plaque builds up in the walls of the arteries, leading to reduced blood flow and an increased risk of heart attack and stroke. To further explore the potential benefits of AMPK activation in treating atherosclerosis (1). The study used a mouse model of induced atherosclerosis and tested the effects of a nanoparticle formulation with collagen on various atherosclerotic parameters, including lesion size, atherosclerotic plaque, and inflammatory reactions. The study results were promising, with the nanoparticle formulation significantly reducing these parameters. This suggests that AMPK activation, in combination with other treatments such as nanoparticle formulations, may be an effective approach to treating atherosclerosis and reducing the risk of cardiovascular disease. While there is still much to be learned about the effects of AMPK activation on vascular tissues and the cardiovascular system, the evidence suggests that it may play an important role in reducing the risk of atherosclerosis and other cardiovascular diseases. Further research is needed to fully understand the mechanisms underlying these effects and to develop effective treatments based on this knowledge.
Conclusion
The study found that costus-loaded nanoparticles can greatly reduce genetic and proteomic pathways linked to atherosclerosis in rat models. The positive control group did not show significant improvement. The study provides a potential solution to the growing problem of atherosclerosis and sheds light on the potential benefits of costus-loaded nanoparticles in reducing the effects of atherosclerosis and improving overall health. Further research can be conducted to investigate costus-loaded nanoparticles' effectiveness in treating atherosclerosis in humans.
Acknowledgments
The authors thank the University of Mosul and the College of Veterinary Medicine for supporting our study.
Conflict of interest
The authors declare that they have no conflict of interest.