Traditional and molecular identification of Haemonchus contortus and Eimeria spp in slaughtered sheep in Al-Diwaniyah city, Iraq

1. The presence of contortus eggs in 63 (37.1%) samples and Eimeria spp oocysts in 39 (22.9%) samples of the intestinal contents.
2. The RT-qPCR showed that contortus was detected in 49/63 (77.8%) samples and Eimeria spp in 18/39 (46.2%) positive microscopic samples of the intestinal contents.
3. The importance of Haemonchus contortus and Eimeria spp in the intestinal content samples of the examined sheep from Al-Diwaniyah city, Iraq, was displayed.

Introduction

Sheep anemia may be caused by several different conditions. One such condition is haemonchosis, which is caused by Haemonchus contortus. It is one of the leading causes of anemia in small ruminants in several world regions (1-6). The parasitic nematode H. contortus belongs to the Trichonstrongylidae family of the Strongylida order of the Nematoda phylum. H. contortus is well-suited to many climates, although it does exceptionally well in rainfall tropical regions (7-9). Historically, haemonchosis was more prevalent in high-risk places, but as the globe warms and new regions become habitable, H. contortus may be able to live and thrive there as well. Therefore, haemonchosis should always be considered a possible cause of anemia or mortality in sheep (10-13). H. contortus requires a warm, wet environment for its free-living stages to thrive and persist outside the host. Haemonchosis may happen at any time of year if the right circumstances occur. Disease is most common, and H. contortus is most likely to survive in regions with a tropical environment (14,15). Larvae can survive and develop in the humid summers and autumns in the warm temperate. Because the free-living larval stages of H. contortus need much moisture to survive, haemonchosis is rare in dry parts of the globe. Larvae may live in warmer, dry locations with enough precipitation or irrigation (16-18). Temperatures between 22 and 26°C and relative humidities around 100% are ideal for the hatching and developing H. contortus eggs and larvae. Larvae may overwinter in parched feces and contribute to an outbreak following rainfall. The larval development period is more variable but may be as little as four days under optimal circumstances (from egg to infective third-stage larvae). Low humidity and desiccation kill eggs and larvae quickly (19-21). The unsheathed L3 larvae, which are the most robust free-living form and may live for extended periods provided the temperature and humidity are favorable, retain the cuticle of the second-stage larvae. The L3 emerges from the feces, lands on the soil, and proceeds laterally and vertically without needing supplemental water (22). The larvae do not eat and instead depend on their reserves. Larvae may survive the winter in various areas because they are dormant (more than freezing), need little energy, and can live for an extended time. Since L3s are more active and utilize energy reserves faster in tropical conditions, their average lifespan is fewer than five weeks (23,24). The economic impact of ovine coccidiosis has been highly documented. One or more species of Eimeria cause infections in sheep, with E. ovinoidalis and E. crandallis being the most dangerous. Eimeria spp. was widely thought to infect sheep and goats until the last three decades. Trials of interspecies transmission showed that Eimeria is species-specific in sheep and goats (25).

The current study was conducted to traditionally and molecularly detect Haemonchus contortus and Eimeria spp in intestinal fecal contents of slaughtered sheep in Al-Diwaniyah City, Iraq.

Materials and methods

Ethical approve

The study was approved and carried out at the College of Veterinary Medicine, University of Al-Qadisiyah with approval number (P.G, No. 1890 in 2020) during the period September to December 2022 according to the international guidelines for the care and use of animals.

Samples

The investigation started with collecting 170 samples of fecal contents from the intestines of slaughtered sheep. The study was conducted from September to December 2022. The intestinal content samples were taken and transported in a cool box to the Laboratory of Parasitology, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah City, Iraq.

Microscopic examination

The flotation technique was followed to separate the oocysts of the parasites. Standard fecal analysis calls for centrifuging 2-5 g of feces and weighing the resulting pellets. 10 ml of the saturated salt solution should be added to the debris. The contents were poured through a fine mesh strainer into a beaker. The filtered mixture has to be placed in a 15-ml centrifuge tube. The mix was left to make a thin layer of flotation solution to the tube. The centrifuge was set at 1,200 RPM (280 g) for 5 minutes. The method was previously performed by Dryden et al. (26).

Extraction of DNA

The DNA extraction was done using methods from Högberg et al. (27), in which 10ml NaCl-saturated solution was applied to 5gms of intestinal contents. This mixture was gauze-filtered and 4000rpm-centrifuged for 3mins. The supernatant at 500µl was used to start the extraction method. The DNA was evaluated for integrity using a NanoDrop.

Real-time quantitative PCR

The primers purchased from Macrogen (Korea) were F: GGCGGGAACAAGTTGAACAGT and R: CCCTAAAATTGATCTTAAACCC (mt-COI region) for H. contortus (28) and F: CGCGCAAATTACCCAATGAA and R: ATGCCCCCAACTGTCCCTAT (18s rRNA gene) for Eimeria spp (29). The reaction contained 2µl DNA, 4µl) of H2O2, 10µl water, and 2µl of each primer for a total volume of 20µl. The methods were followed by Zhu et al. (30). The thermocycling steps were 40 cycles of denaturation 95ºC, annealing 60-50ºC, and extension 72ºC. The annealing temperatures were different for either parasite (31,32).

Statistical analysis

T-test was used via GraphPrism v7.0 (GraphPad Inc., USA) to compare the levels of both parasites. A p-value of less than 5% was used.

Results

The findings of the microscopic examination revealed the presence of H. contortus eggs in 63/170 (37.1%) samples and Eimeria spp oocysts in 39/170 (22.9%) samples of the intestinal contents. The RT-qPCR showed that H. contortus was detected in 49/63 (77.8%) samples and Eimeria spp in 18/39 (46.2%) positive microscopic samples of the intestinal contents (Figure 1).

Figure 1: Real-time quantitative PCR of Eimeria spp and Haemonchus contortus in feces of sheep intestinal content. A and B: Optimization and RT-qPCR findings for Eimeria spp (Red) and Haemonchus contortus (Blue).

Discussion

The present study found that H. contortus oocysts were identified using microscopy in 37.1% samples. Höglund et al. (33) showed that oocysts were found in 56% microscopic samples. The current work identified the occurrence of Eimeria spp oocysts in 22.9% microscopic samples. Majeed et al. (34) found that microscopic examination recorded the presence of oocysts in 100% fecal samples. Some novel methods for identifying Haemonchus spp. appeared with the introduction of RT-PCR. Although RT-PCR was initially developed to measure gene transcription, many labs have begun using it to replace traditional PCR in the identification methods of intestinal parasites (35-37).

With the advent of real-time PCR, researchers’ attention has shifted from assay creation to practical applications. Despite the study's narrow emphasis on cultured larvae, Siedek et al. (37) found a strong association between probe-based real-time PCR results and coproculture. The approach of growing to L3 and then examining the parasites morphologically has been thoroughly reviewed (38-40), but since then, researchers have shifted their focus to antemortem PCR-based detection of fecal eggs. Numerous publications have been published in combination with carrying out molecular assays on fecal eggs, in which the separation of eggs was not preceded by purification and DNA isolation. For example, Sweeny et al. (41) extracted DNA from ovine feces and successfully performed specific PCR. Egg flotation experiments where the epg was more than 50 correlated well with the data. However, the egg detection borderlines were never identified, and cultures of the fecal eggs were never undertaken to verify the PCR results. To use real-time PCR for quantitative (qPCR) assessment of larval loads on pasture (42). Due to the presence of both L3s and eggs on pasture, a weak relationship was seen between Cts and pasture larval counts. The qPCR results were positive, nevertheless. Subsequently, McNally et al. (43) devised a technique for extracting DNA from sheep feces to quantify eggs from Haemonchus. Using this method, the test demonstrated 10epg-based sensitivity (42,43).

In mixed-species infections, efforts have been undertaken to quantify fecal eggs. Quantification can determine the densities of eggs. The DNA content and alterations in the gen amplification across species may render molecular amplification of fecal eggs ineffective (44). The first does not seem to be a problem based on anecdotal information, and the latter may be handled by carefully regulating test conditions and parameters. DNA can change its amount, which may interfere with the quantification in the first 6-7 hours following embryonation (45). RT-qPCR was initially used to quantify sheep gastrointestinal nematodes (46-52).

Conclusion

The present investigation displays significant Haemonchus contortus and Eimeria spp occurrences in the intestinal content samples of the examined sheep from Al-Diwaniyah city, Iraq.

Acknowledgments

The authors thank Professor Jabbar Ahmed Alssady, Dean of the College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, for technical assistance.

Conflict of interests

The authors have not received any funding or benefits from industry, financing agencies, or elsewhere to conduct this study.