Introduction
Chlamydial abortion results in significant reproductive disorders in numerous sheep-farming regions worldwide, with New Zealand and Australia as notable exceptions (1). The disease is particularly prevalent in flocks that are intensively maintained throughout the lambing season, and it remains the most frequent reason for abortion in many countries worldwide. The primary host of the disease is sheep; goats are also impacted, as are cattle and deer (2). Greig first identified chlamydia abortion in 1936 under the name enzootic abortion of ewes (EAE) (3), and the disease was for the first time detected in Iraq (4). Chlamydia is an obligate intracellular, Gram-negative organism that has a unique biphasic life cycle; they have two morphological structures called the Elementary Body (EB), which is the infective form, and the Reticulate Body (RB), a form of the metabolically active bacterium (5). In scientific reports, more than 60 Chlamydial diseases are known in mammals, in addition to infecting 465 species of domestic and wild birds, as well as causing 30 diseases in humans; this is because they closely resemble in their biological characteristics that they are only represented by a single genus Chlamydia, which includes all currently described species (6). Chlamydia is classified as a biological paradox. One paradoxical trait is the group's unified antigenic structure; this antigenic unit includes a wide range of pathogenicity, which is why the importance of these organisms should not be overlooked. Chlamydia has been listed by the OIE as a class B notifiable disease. Among the most important of these types is Chlamydia abortus, which causes Chlamydial abortion, a disease of high importance that is also referred to as Ovine enzootic abortion (OEA) and Enzootic abortion of ewes (EAE), which is endemic in sheep. Chlamydia abortus can be detected by microscopic examination by using special stains like modified Ziehl-Neelsen MZN, which will show EB of Chlamydia abortus in a large number of red dot-shaped bodies on a blue background that colors the epithelial cells and the rest of the bacteria (7). Clinically, Abortions in late pregnancy typically do not have any warning signs before they happen. Ewes do not appear to experience systemic effects, but goats can develop metritis and retain the placenta. Following an abortion, vaginal discharge that lasts up to 3 weeks is standard. Stillbirths, weak-born lambs, and kids that die soon after birth cause additional losses (5), as necropsy findings Aborted fetuses do not have any apparent abnormalities. The inter-cotyledonary areas are thickened, edematous, and leathery, and the placental cotyledons are necrotic and hemorrhagic. Chlamydial organisms can be observed in the cytoplasm of swollen trophoblasts in direct placental smears using modified Ziehl-Neelsen MZN or other suitable stains (5); aborted fetuses do not have any apparent abnormalities. The inter-cotyledonary areas are thickened, edematous, and leathery, and the placental cotyledons are necrotic and hemorrhagic. Chlamydial organisms can be observed in the cytoplasm of swollen trophoblasts in direct placental smears using modified Ziehl-Neelsen MZN or other suitable stains (5). Chlamydia can be diagnosed by many techniques and confirmed by a Polymerase chain reaction that allows direct identification of the causal agent and species differentiation based on DNA from clinical samples. Many different PCR protocols have been used and adopted by various researchers. It has been established that PCR is highly durable for regular use and for further confirmation assays and has proven to be the most sensitive among several protocols, but the fact is that primers have been created. Based on the traditional classification of species according to the latter classification, some tests that could be pertinent to veterinary diagnostic laboratories often rely on published conventional PCR techniques on specific genetic targets such as the S16rRNA gene, OMP2, and the MOMP gene, each specific to an antigen region, between a specific genus and species, ideal targets for PCR diagnostics, additionally for assays of intra-species differentiation and need to use more than one gene to confirm infection (8). Middle Eastern countries have reported Chlamydia. Therefore, numerous studies were accomplished in Turkey; Chlamydia was identified by PCR technique in 6% of the vaginal swab samples of ewes and goats (9), and in Iran (10) found that 24.1% of sheep have Chlamydia abortus by real-time PCR technique, furthermore, in Saudi Arabia, Chlamydia was isolated from tissue samples taken from goat and sheep, like aborted fetuses and vaginal swabs (11). In Jordan, 21.8% of sheep and 11.4% of a goat was positive for Chlamydia by complement fixation test (CFT) (12), and in Syria, a positive titer for Chlamydia in sheep and goats was 11.7%, and 10.8%, respectively were detected by ELISA (13). Abortion is caused by many factors such as toxoplasmosis (14), although there are many studies on the detection of abortion caused by Chlamydia in sheep in Iraq (15-21) and in Nineveh (22,23), also Alameen and Dahl (24) mentioned that Chlamydia abortus is one of the primary causes of abortion in Nineveh.
This study aimed to detect Chlamydia abortus using microscopic examination by Modified Ziehl-Neelsen stain (MZN) and conventional polymerase chain reaction (c-PCR) and to compare them and to find the appropriate test, furthermore to explore the definitive sample for diagnosis.
Materials and methods
Ethical approval
This study was ethically permitted by the Institutional Animal Care and Use Committee of the College of Veterinary Medicine, University of Mosul (UM.VET.2022.069) on 15 Sep 2022.
Animals of study
Our study was conducted on 157 samples from 75 ewes representing 60 flocks (10903 ewes). We took all three types of samples from the same ewe as possible. Samples were attended from ewes who suffered from abortion 1-3 years of age of local breed (Awassi, Hamdani, local crossbreed) from various areas of Mosul, Iraq; the study was conducted from August 2022 to January 2023.
Sample collection
Samples included taking swabs from the vagina of aborted ewes, the placenta, and the stomach contents of aborted fetuses. Cotton swabs were used to smear the glass slides for the Microscopic Examination. Biopsies were taken from the placenta and from the organs of aborted fetuses (liver, abomasum), which were transported in special containers and under refrigerated conditions 4-8 °C and a buffer solution (Sucrose-Phosphate-Glutamate Buffer, SPG BUffer) was added to them (25), It was kept at a temperature of -20°C until PCR made the diagnosis, samples included 49 aborted fetuses, 52 placentas, and 56 vaginal swabs.
Microscopic examination
Swabs were spread on glass slides to make smears, left to completely dry, and then fixed with absolute methanol, and a Ziehl-Neelsen stain prepared by the SYRBIO (Syria) was used. A carbol fuchsin stain was used for 15-20 minutes. The slide was washed with water, and diluted acid alcohol was used for color reduction for 15-20 seconds. Then, the slide was washed with water, and the contrast methylene blue stain was used for 1-2 minutes. The slide was left to dry and then examined under a light microscope using a 40x magnification lens first and then a 100x magnification lens to detect the Elementary Body (EB), which appeared in red on a blue background that colors the epithelial cells and the rest of the bacteria. The acid alcohol was diluted by 1 ml of concentrated acid alcohol to 200 ml of distilled water (26).
Extraction of DNA
A DNA extraction kit (ADDBIO, South Korea) was used to extract the DNA from the samples. The procedure was carried out by the manufacturer's instructions.
Amplification of DNA
Primers prepared from (Macrogen, South Korea) were used to amplify specific parts of DNA during the polymerase chain reaction, and their sequences and sizes are shown in table 1.
Table 1: Primer sequence of 16-S rRNA gene and OMP2 to confirm Chlamydia abortus in infected sheep
|
Gene
|
Primers
|
A sequence of the primers (5- to 3-)
|
Size (pb)
|
Reference
|
|
16S rRNA
|
16SIGF
|
GATGAGGCATGCAAGTCGAACG
|
278
|
(27)
|
|
16SIGR
|
CCAGTGTTGGCGGTCAATCTCTC
|
|
OMP2
|
F
|
ATG TCC AAA CTC ATC AGA GGA G
|
587
|
(28)
|
|
R
|
CCT TCT TTA AGA GGT TTTACC CA
|
Master mix preparation
The master mix for all polymerase chain reactions was prepared using the master mix kit (GeNetBio, South Korea), and for each reaction, a pair of specialized primers representing the gene to be detected was used. After the additives had been properly mixed, they were distributed in a volume of 15 microliters on Eppendorf tubes with a capacity of 200 microliters. After that, the DNA was added in a volume of 3 microliters in the particular tube for each sample so that each tube's overall volume was 20 microliters.
Programming the thermocycler
After preparing the tubes of the PCR mixture, they were placed in a thermocycler to amplify the gene to be detected. Denaturation at 94°C for 10 minutes for one cycle was the first step in the thermocycler program. Then, 40 cycles of denaturation were performed. (94°C for 45 seconds), Forty cycles of annealing for 45 seconds at (60°C for 16 S IGF, 16 S IGR, and 55°C for OMP-F, OMP-R), and 40 cycles of extension (72°C for 1 minute) a final extension were run for seven minutes at 72 °C, according to the manufacturer’s instructions (Macrogen, South Korea).
Electrophoresis in an agarose gel:
A 1.5% agarose gel concentration was prepared by dissolving 1.5% agarose in 100 ml of 1Tris-borate-EDTA X buffer, adding three microliters of (Gel red safe) dye. After that, seven microliters of the amplification products resulting from the polymerase chain reaction were placed in the specified pits (DNA Invitrogen, USA), ladder 100bp, and four microliters of it were placed in the first hole in the agarose gel. The power supply was connected to 80 volts and (300) milliamps for 60 minutes. The gel was placed in a particular imaging device (Gel Documentation System BioRad, USA) that sheds ultraviolet light to detect amplification products, and then the images of the results were compared with a 100 bp DNA ladder.
Statistical analysis
Data from our study were analyzed by IBM-SPSS (IBM Corp., Armonk, NY, USA) v21. Using the Chi-square test to test the association between the two tests (29). Cramer's Value was used to determine the strength of the association between the two tests. Cramer's Value is a number between zero and 1, indicating the strength of association between the two tests (30,31). Additionally, the microscopic examination's sensitivity, specificity, and accuracy were assessed compared to the PCR as a gold standard (32). Accuracy, Sensitivity, and Specificity were calculated according to the following Mathematical formulas: Sensitivity= TP/ TP+FN, Specificity=TN/TN+FP, Accuracy=TP+TN/TP+TN+FP+FN. Using Spearman's rank coefficient of correlation to measure the correlation between test results according to the type of sample (5), where the data of the animals from which the samples were collected were identified in their three types (placenta, fetus, vaginal smear), which There were 26 ewes to determine the association between the types of samples (29).
Results
The results showed that out of total 157 samples comprise of (52 placenta, 49 fetuses, and 56 vaginal swabs), 18.47% were identified positive using microscopic examination stained with Modified Ziehl-Neelsen/MZN and 11.46% were confirmed for Chlamydia abortus by Conventional Polymerase chain reaction (c-PCR) for (16S rRNA) (Table 2).
Table 2: The number and percentage of samples with Chlamydia abortus using microscopic examination (MZN) and PCR
|
Tests
|
N. of samples
|
N. of positive samples
|
Percentage (%)
|
|
Microscopic examination (MZN)
|
157
|
29
|
18.47%
|
|
PCR
|
18
|
11.46%
|
Laboratory diagnosis of Chlamydia abortus
Chlamydia was detected, according to the results in the samples examined under Microscopic examination using the Modified Ziehl-Neelsen stain in different proportions, as they were 16.3, 26.9, and 12.5% for each of the samples of the placenta, aborted fetus, and vaginal swab, respectively, smears stained with Modified Ziehl- Neelsen -MZN show Elementary Body (EB) of Chlamydia abortus in a large number of red dot-shaped bodies in the intercellular space and also in the cytoplasm of the trophoblasts of the placenta (Figures 1 and 2).
Figure 1: Vaginal smear stained with Modified Ziehl-Neelsen- MZN stain, A-Extracellular EB, B-Intracellular EB (X1000).
Figure 2: Placental smear showed EB of Chlamydia abortus stained with Modified Ziehl-Nielsen (MZN) stain (X1000 Light Microscope).
Molecular detection of Chlamydia abortus bacteria
The results showed that the molecular detection using (c-PCR) 18 samples 11.46% were confirmed by the 16S rRNA gene with an amplicon size of 278pb, while seven samples 4.45% for the OMP2 gene. These results are presented in (Table 3). The amplification products of the gene S16rRNA of the positive samples showed a size of 278 pb and 578 pb for OMP2 compared to the negative control after electrophoresing in a 1.5% agarose gel (Figure 3 and 4).
Table 3: Percentages of primers for the two genes (S16rRNA, OMP2) using conventional PCR
|
Gene name
|
Primers
|
Sequences 5’-3’
|
Size (bp)
|
Positive samples
|
Percentage (%)
|
|
S16rRNA
|
16SIGF
|
GATGAGGCATGCAAGTCGAACG
|
278
|
18
|
11.46%
|
|
16SIGR
|
CCAGTGTTGGCGGTCAATCTCTC
|
|
OMP2
|
F
|
ATG TCC AAA CTC ATC AGA GGA G
|
587
|
7
|
4.45%
|
|
R
|
CCT TCT TTA AGA GGT TTTACC CA
|
Figure 3: Agarose gel electrophoresis of PCR products for detecting Chlamydia abortus using primer 16SIGF-F and 16SIG-R of the gene (16S rRNA). Path M: Marker is 100 bp. Lane 1 - 18 represents positive samples with an amplicon size of 278 bp; lane 19 represents the negative control.
Figure 4: Agarose gel electrophoresis of PCR products for detecting Chlamydia abortus using primer OMP-F and OMP-R of the (OMP2) gene. Lane M: Marker represents 100 bp size. Lane 1 - 7 represents positive samples with amplicon size 587 bp; Lane 8 represents negative control.
In the comparison of the two methods' results, the microscopic examination (MZN) with the polymerase chain reaction (PCR) as a gold standard, it was found that there were 14 valid positive samples for both tests, 124 valid negative samples for both tests, 15 false positives, and four false negative samples and sensitivity was 78%, specificity was 89%, accuracy was 89%. Positive predictive Value (PPV) was 48%, and Negative predictive value (NPV) was 97%. According to the result of statistics, there is a moderate strength association between microscopic examination (MZN) and the PCR, as the chi value was 47.48 and the Cramar Value 0.55 at a significant level of P<0.01 in diagnosing Chlamydia abortus in sheep herds in Mosul (Table 4).
Table 4: Comparison of microscopic examination (ME) and conventional PCR technique (c-PCR)
|
|
Conventional PCR technique
|
|
Positive
|
Negative
|
Total
|
|
Positive
|
14*
|
15
|
29
|
|
Negative
|
4
|
124**
|
128
|
|
Total
|
18
|
139
|
157
|
* = true positive, **= true negative.
From the results of different samples (placenta, fetus, vaginal swab) examined with a microscopic examination by Modified Ziehl-Neelsen stain and PCR, they were positive placenta 14.2%, aborted fetus 15.3%, and vaginal swab 5.3% samples, furthermore, by Spearman's rank coefficient there is a positive correlation between samples of fetuses and vaginal swabs with samples of the placenta, as the correlation value was 0.7654 and 0.7706 for samples of fetuses and vaginal smears, respectively, at a significant level of P<0.01 (Table 5).
Table 5: Infection percentages of Chlamydia abortus according to the type of sample in ewes using MZN and PCR
|
Sample type
|
Tested samples
|
Test type
|
Positive samples
|
Percentage (%)
|
|
Placenta
|
52
|
Microscopic examination
|
14
|
26.9%
|
|
PCR
|
8
|
15.3%
|
|
Aborted fetus
|
49
|
Microscopic examination
|
8
|
16.3%
|
|
PCR
|
7
|
14.2%
|
|
Vaginal swab
|
56
|
Microscopic examination
|
7
|
12.5%
|
|
PCR
|
3
|
5.3%
|
Discussion
Our study aimed to detect Chlamydia in ewes’ flocks in Mosul by two laboratory tests to compare between microscopic examination using the Modified Ziehl-Neelsen stain and the c-PCR. This study was also focused on finding the most desirable and representative sample for early diagnosis of diagnosis. The current findings revealed that out of 157 samples collected from different tissues, 29/18.47% were using microscopic examination with the MZN, which is considered a high number of favorable results compared with other researchers (33,34). Chlamydial abortion is an endemic disease in Iraq due to the close movement of sheep between the Iraqi governorates, while our result disagrees with Cati et al. (19), Majed et al. (23) and Al-Magsoosi et al. (35) because positive samples increase if the disease occurs for the first time in the region. It may also be due to several factors, including the number of animals, the type and size of the sample examined within the herd, husbandry practices, the breeding procedures, the health status of the animals, improper breeding, and failure to dispose of aborted fetuses and infected discharge properly. Some other associated factors comprising virulency of the pathogen, susceptibility to infection, and the advanced stage of pregnancy can also play vital roles in the propagation and transmission of this lethal disease (5).
The result of microscopic examination using MZN, shows EB of Chlamydia abortus. These results agree with Paolo et al. (36) Tsakos (37) and Borel et al. (27), as microscopic examination represents an easy and inexpensive method. The preference for this method increases with the availability of a representative sample, such as the placenta taken close to the time of the abortion to ensure the presence of EB and considered a rapid initial test for the early detection of Chlamydia (2), our results disagree with Sargison and Truyers (38) may be due to the absence of EB in the examined microscopic smear or the presence of a small number of EB, which increases the difficulty of diagnosis, in addition to the difference in the eye of the examiner (39). The reason may be that the contrast stain (carbol fuchsin) needs careful discolorations using dilute acetic acid. Excessive decolorization may lead to difficulty detecting EB (40). In molecular detection using a c-PCR assay, Chlamydia abortus was confirmed in 18/11 (46%) and 7/4 (45%) using the 16S rRNA gene and OMP2 gene, respectively. Our results are reflected in similar findings with other researchers in Turkey and Iran (9,25).
The results disagreed with Esmaeili et al. (10) because of geographical location, animal breed, grazing and management techniques, inadequate dietary intake, and uncontrolled restrictions on the movement of animals from infected areas. Are factors that may affect the rate of Chlamydia abortus infection, geographical areas, environmental elements, soil types (arid, semi-arid), climate, temperature, sunlight, pasture cultivation levels, feeding types, and irrigation sources all play a role in the variation in disease incidence in other countries as well Gillespie and Timoney (41).
Our results disagree with Arif et al. (21), which used only one gene ompA. The reason for preferring the 16S rRNA gene in diagnosis by polymerase chain reaction is that the gene is characterized by the fact that it maintains its sequences for one species and changes slowly over millions of years, and its size is appropriate when conducting the process of determining genetic species and the phylogenetic tree (sequencing), These reasons give strength for the compatibility of the 16S rRNA gene with this study and other studies. It was based on this gene in 1999 and proposed in the reclassification of the Chlamydiales family, which expresses 90% of its identity and distinguishes it as a bacterium from other chlamydia-like organisms (42). In addition, Chlamydia abortus has only one copy of the 16S rRNA gene, unlike chlamydia species that have two copies, and this makes this gene an advantage in recognizing Chlamydia over other genes used in diagnosis (43). From the statistical results, it is reflected that there was a moderate association strength between microscopic examination and PCR, which agrees with Hanger et al. (44) and Madkhali et al. (45) that both techniques depend on the presence of bacteria, and the microscopic examination was sensitive enough to be used in the rapid diagnosis of chlamydia infection.
Our results indicate that 26.9% of pathogens were confirmed from the placental, making it essential for diagnosing EAE. These results agreed with Moore et al. (29), Paolo et al. (36), Tsakos (37), and Creelan et al. (46). The placenta is the target tissue for Chlamydia that produces lesions. The pathogenesis and primary abnormality occurred due to the ability of Chlamydia abortus to colonize in the trophoblasts of the placenta, and the placenta was the most representative for detecting Chlamydia. It also reported that Chlamydia abortus can be confirmed in the placenta because shedding occurs on the 85th day of pregnancy and then gradually increases (47).
Results indicate a correlation between all types of samples (placenta, aborted fetus, vaginal swab) because all these samples have the origin of the urogenital tract. These results agree with Livingstone et al. (48) that diagnosis should include more than one type of sample and the necessity of collecting it immediately or soon after the abortion (36). Vaginal swabs are less representative than other swabs, which may be due to the continuous vaginal secretions, which dilute the causative agent.
Conclusion
Chlamydia abortus can be diagnosed by MZN as an initial screening test, and further conformation should be done by using the PCR assay for the 16S rRNA gene.
Acknowledgment
The authors are highly grateful to the University of Mosul, College of Veterinary Medicine for all the facilities to execute this study.
Conflict of interest
There is no conflict of interest.