Introduction
SPV is a contagious viral infection in sheep that, in endemic regions, commonly manifests in skin lesions with marked fever (1,2). However, it also characterized severe losses, particularly in young animals (3), and import and export restrictions on their byproducts (4,5). SPV is an encapsulated DNA virus with two strands belonging to the family Poxviridae (6). Its linear DNA genome is 130-280 kbp. This vast genome encodes every gene needed for its unique intracellular replication (7). Clinically, the illness is marked by high temperatures of 40-42ºC, conjunctivitis, and rhinitis with enhanced widespread numerous focal necrosis in cutaneous and inner tissues such as the lungs, digestive system, liver, and lymphadenopathy (8,9). Other signs include a decline in milk yield and weight loss, high rates of abortion, increased susceptibility to pneumonia, and high mortality. The geographical distribution of sheep pox has been reported worldwide, and it is endemic in many countries, including China, Nepal, Bangladesh, Iraq, Iran, Turkey, Pakistan, India, and Afghanistan. Individual epidemics are occurring in Southern Europe and other areas of the world due to considerable trade with other international countries (10,11). Poxviruses express host genes through genetic recombination and can evade the host’s immune system (12). One pathway includes that IFN-γ regulates the immunological response of its host cell (13). G-protein coupled chemokine receptor GPCRs or Guanine nucleotide-binding proteins are a group of proteins that have a pivotal role in the cells. Furthermore, MHC class II-restricted antigen presentation is needed for CD4+ T cell-dependent immunological responses, which are required to form an effective and specific immune response (14). There are few studies on sequence analysis of SPV in Iraq (15).
This study aims to detect the SPV by molecular approach targeting multiple genes, including IFN-γ, GPCR, and MHC class II, and compare them with other global sequences, including the vaccine strain. This could help understand SPV strategies for tackling host immunity.
Materials and methods
Ethical approve
The primary studies under which the samples were collected received ethical clearance from Veterinary Medical Ethics Committee of University of Al-Qadisiya with approval number 375/2023.
Clinical samples
This is the study that has been carried out. In Diwaniyah, Iraq (Al Sannih, Daghara, and Al Badir) from September 2023 to January 2024, a total of 600 Awassi and Al Nuaimi sheep of different ages were examined, and 125 of them were found to be suspected of being infected with SPV. Suspected sheep showed high temperature and skin lesions characterized by 0.25-3 cm of hyperemia and multiple nodular skin lesions widely distributed over the body, especially under the tail, head, perineum, axillae, and udder. In some areas, these spots developed into papules without vesicles that form scabby tissues. Samples were collected aseptically, transported to the laboratory using the cold chain protocol, and maintained at -20ºC until utilized for molecular technique.
Genomic DNA extraction
Skin lesions were put into a Sterilized Petri plate. Minced into smaller pieces with sterile scissors, Transfer to a sterile 1.5ml microcentrifuge tube, homogenize using tissue lysis buffer (AddBio, South Korea), and purified using a silica-based column according to the manufacturer's instructions (ADDBio, South Korea). Eluted DNA was kept at -20 °C until further analysis.
Polymerase chain reaction (PCR)
Amplification of the targeted genes using primers designed in this study (Table 1), specific to SPV. The reaction consists of PCR master mix (ADDBio, South Korea) including 0.4 μl of Taq polymerase, two μl of dNTPs, 6.6 μl of 10X PCR buffer with two μl of each primer (for IFN-γ, GPCR, and MHC class 2) and two μl of template viral DNA, and seven μl of PCR water. PCR thermocycler conditions were done using a conventional PCR thermocycler system, as shown in (Table 2). PCR products were electrophoresed (at 100 volts and 80 AM for 1 hour) by agarose gel 1.6%, stained with ethidium bromide, and illuminated by a gel documentation system (Syngene, Taiwan).
Table 1: Three sets of primers were designed in this study targeting the IFN-γ, GPCR, and MHC class 2 genes of sheep pox virus
|
Target gene
|
Sequence ‘5-------3’
|
Size
|
Accession number
|
Start
|
End
|
|
IFN-γ
|
Forward
|
CCGAATTCGCCGTTTAAGCA
|
563 bp
|
MN072630
|
106
|
125
|
|
Reverse
|
GCGGAGAATGGAAACAAGCA
|
668
|
649
|
|
GPCR
|
Forward
|
ATCCCACACTGTGATGATGGT
|
889 bp
|
KT438551
|
217
|
237
|
|
Reverse
|
CAACACTACTGGTGCTACGC
|
1105
|
1086
|
|
MHC class 2
|
Forward
|
ACTTCATTTTCAACAAAGACGAGGA
|
541 bp
|
MN072626
|
11
|
35
|
|
Reverse
|
TCCACAATACACCACCCACT
|
551
|
532
|
Table 2: PCR thermocycler conditions
|
PCR step
|
Temp.
|
Time
|
Cycle
|
|
Initial Denaturation
|
95°C
|
3min
|
1
|
|
Denaturation
|
95°C
|
35sec
|
39
|
|
Annealing
|
55°C
|
35sec
|
|
Extension
|
72°C
|
35sec
|
|
Final extension
|
72°C
|
5min
|
1
|
DNA Sequencing method
Ten samples from each gene were chosen from the positive PCR samples for DNA Sanger sequencing via bidirectional sequence by Macrogen (South Korea). They were slightly trimmed from noise signals and then analyzed for phylogeny using SNAP Gene software. These sequences were submitted to NCBI to obtain accession numbers.
Phylogenetic analysis
A phylogenetic tree and Multiple sequence alignments were constructed using partial sequences of the three genes of local SPV strains using (Mega X software) by maximum likelihood (Tamura-Nei model) with 1000 bootstrap.
Statistical analysis
Chi-square (x2) and t-tests were used to demonstrate the significant differences between infected and non-infected sheep at a statistical level of P<0.05 (16).
Results
Infection percentage
The PCR findings were detected in 40 samples based on 125 sheep of both gender genders and ages selected. The result revealed that 32%. At the same time, 85 samples (68%) were found negative for sheeppox viral DNA (Table 3). As shown in (Table 4); the positively infected sheep were classified into four age categories; according to their gender, out of 43 males, 15 sheep were positive for SPV infection by PCR, as depicted in (Table 5). Statistically, there was a significant difference between Positive and negative cases.
Table 3: Percentages of positive sheep pox cases by PCR
|
Values
|
Sheep n (%)
|
|
Infected sheep
|
40 (32%)
|
|
Non-infected sheep
|
85 (68%)
|
|
Total
|
125 (100%)
|
|
Chi-square value
|
32.4
|
|
P-value
|
<0.0001 (HS)
|
HS: Highly significant difference at P<0.01.
Table 4: Positive cases in sheep according to sheep age
|
Age (month)
|
Total number
|
Sheep n (%)
|
|
<1-6
|
20
|
6 (30%)
|
|
7-12
|
54
|
22 (37.03%)
|
|
13-18
|
26
|
8 (30.76%)
|
|
19-24
|
25
|
4 (16%)
|
|
Total
|
125
|
40 (32%)
|
|
x2
|
4.89
|
|
P value
|
0.180 (NS)
|
Table 5: Positive cases according to sheep gender
|
Age (month)
|
Total number
|
Sheep n (%)
|
|
Male
|
43
|
15 (34.88%)
|
|
Female
|
82
|
25 (30.48%)
|
|
Total
|
125
|
40 (100%)
|
|
x2
|
0.251
|
|
P value
|
0.617 (NS)
|
Detection of sheep pox virus genes by conventional PCR Assay
The PCR results were detectable in 40 samples out of 125 suspected sheep. Ten samples from the positive PCR technique were sequenced for IFN-γ, GPCR, and MHC class 2 genes. After electrophoresis, the results out of 125 skin lesions, 40 samples produced bands with anticipated sizes of 536 bp (Figure 1), 889 bp (Figure 2), and 541 bp (Figure 3) that corresponded to the universal ladder at 200-1500 bp. In comparison, 85 samples of skin lesions 68% tested negative for sheep pox virus DNA by PCR. The detection of SPV viral DNA in animals suffering from skin symptoms was statistically significant compared to animals with suspected infection.
Figure 1: An agarose gel electrophoresis image (1.6 % agarose) shows positive amplicons (1-8) of sheep pox virus targeting a partial region of the Interferon-gamma receptor gene (size = 563 bp). NC is a negative control in which similar PCR conditions were used, except H2O was added instead of DNA.
Figure 2: An Agarose gel electrophoresis image (1.6 % agarose) showing positive amplicons (1-8) of the pox virus targeting a partial region of the G-coupled protein receptor gene (size = 889 bp). M is a molecular marker from Genedirx (South Korea).
Figure 3: An agarose gel electrophoresis image (1.6 % agarose) shows positive amplicons (1-8) of sheep pox virus targeting a partial region of the MHC Class 2 Presentation Inhibitor gene (size = 541 bp). NC is a negative control in which similar PCR conditions were used, except H2O was added instead of DNA.
Gene sequence and phylogenetic analysis
In the IFN-γ gene sequence, ten local strains were submitted in the NCBI database, including OR542752, OR542753, OR542754, OR542755, OR542756, OR542757, OR542758, OR542759, OR542760, and OR542761 (Table 6). These were analyzed and compared to NCBI Gen Bank, which showed some genetic variances between the identified strains and retrieved sequences from NCBI. Phylogenetic tree analysis showed that there was a similarity between locally detected strain and global stain (99.52-100%) (Figure 4). Eight sequences (accession no. OR542752, OR542753, OR542754, OR542755, OR542757, OR542758, OR542759, OR542760) have the same identity 100% in comparison with homologs global sequence in China, Abu Charb, Saudi Arabia, and Turkey, and the sequence OR542756 and OR542761 have identity at 99.52% in China and Abu Charib.
In GPCR phylogenetic analysis, the local SPV strains with accession numbers (OR542742, OR542743, OR542744, OR542745, and OR542746) are 100% similar to Turkey's global sequence, while the sequence strains (OR542747, OR542748, OR542749, OR542750, and OR542751) are 99.68% homology with Turkey's global sequence, Abu Gharib, Saudi Arabia (Figure 5). Ten SPV local strains (OR542762, OR542763, OR542764, OR542765, OR542766, OR542767, OR542768, OR542769, OR542770, and OR542771) were compared to NCBI Gen Bank SPV strain found in the MHC class 2 gene. The results revealed variance between the local strains and retrieved sequence from NCBI as nine sequences with (accession no. OR542762, OR542763, OR542764, OR542765, OR542767, OR542768, OR542769, OR54270, OR54271) share 99.79% identity with homology with China, Abu Charb, Saudi Arabia, Turkey, and Nigeria, with the sequence OR542766 sharing 100% identity with Abu Charib strain (Figure 6).
Table 6: Local SPV strains with their accession numbers
|
No
|
Local strains
|
Accession number
|
|
IFN-γ gene
|
GPCR gene
|
MHC CLASS II gene
|
|
1
|
Sheep pox virus
|
OR542752 |
OR542742 |
OR542762 |
|
2
|
Sheep pox virus
|
OR542753 |
OR542743 |
OR542763 |
|
3
|
Sheep pox virus
|
OR542754 |
OR542744 |
OR542764 |
|
4
|
Sheep pox virus
|
OR542755 |
OR542745 |
OR542765 |
|
5
|
Sheep pox virus
|
OR542756 |
OR542746 |
OR542766 |
|
6
|
Sheep pox virus
|
OR542757 |
OR542747 |
OR542767 |
|
7
|
Sheep pox virus
|
OR542758 |
OR542748 |
OR542768 |
|
8
|
Sheep pox virus
|
OR542759 |
OR542749 |
OR542769 |
|
9
|
Sheep pox virus
|
OR542760 |
OR542750 |
OR542770 |
|
10
|
Sheep pox virus
|
OR542761 |
OR542751 |
OR542771 |
Figure 4: Evolutionary analysis by the Maximum Likelihood method of sheep pox virus (Interferon gamma receptor gene). This was inferred by the Tamura-Nei model and drawn to scale, with branch lengths measured in the number of substitutions per site (below the branches). This analysis involved 14 nucleotide sequences. The final dataset had 414 positions. Evolutionary analyses were conducted in MEGA11.
Figure 5: Evolutionary analysis by the Maximum Likelihood method of sheep pox virus (G-coupled protein receptor gene). This was inferred by the Tamura-Nei model and drawn to scale with branch lengths measured in the number of substitutions per site (below the branches). This analysis involved 13 nucleotide sequences. The final dataset had a total of 312 positions. Evolutionary analyses were conducted in MEGA11.
Figure 6: Evolutionary analysis by the Maximum Likelihood method of sheep pox virus (MHC Class 2 Presentation Inhibitor gene). This was inferred by the Tamura-Nei model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site (below the branches). This analysis involved 16 nucleotide sequences. The final dataset had 471 positions. Evolutionary analyses were conducted in MEGA11.
Multiple sequence alignment
As shown in table 7, in the alignment of INF-gamma receptor, GPCR, and MHC Class2 presentation inhibitor genes, there were some genetic replacement mutations. According to the NCBI-Blast that explained the relationship of Iraqi strains with global strains, Interferon gamma receptor, in which a high similarity between the sites nucleated number 54-60, 22-26, and 4-8, conserved for specific changes in particular nucleotides in distinct sites of the gene. In sheep pox -OR542761-sequence 10, A (adenine) replaces T (Thymine) in other strains in the alignment. At site 376 in sheep pox -OR542756-sequence 5, A (adenine) was nucleated instead of T (Thymine) while aligning the G-coupled protein receptor gene, there is a high degree of similarity between the nucleated sites 5-9 except for certain changes in specific nucleotides in distinct locations of the gene sequence. Different nucleotides, C (Cytosine) instead of T in three sequences (OR542748, OR542749, OR542750), were examined by Mega X. The alignment of the MHC Class 2 Presentation Inhibitor gene sequence of sheep pox revealed considerable similarity between the nucleated number 15-24 and 302-309, conserved for specific changes in particular nucleotides at distinct gene locations. Sequence no. 332 is different in (OR542762, OR542763, OR542764, OR542765, OR542766, and OR542771) in which C instead of A in other strains in the alignment. The phylogenetic tree study used partial sequencing of IFN-γ, GPCR, and MHC class 2 genes from local SPV strains for genetic validation.
Table 7: The site of mutation in the multiple sequence alignment analysis
|
Gene
|
Obtained Accession number
|
Site of mutation
|
|
Interferon-gamma receptor
|
OR542761-sequence 10
OR542756-sequence 5
|
A (adenine) replaces T (thymine)
|
|
G-coupled protein receptor
|
OR542748
OR542749
OR542750
|
C (Cytosine) instead of T
|
|
MHC class 2 presentation inhibitor
|
OR542762
OR542763
OR542764
OR542765
OR542766
OR542771
|
C instead of A (adenine)
|
Discussion
This study showed that some local strains have point mutations in their nucleotides. However, others are highly similar. PCR results demonstrated that positive samples within different areas of Al-Diwaniya reached 32%. This result agrees with another studies Chala (17) that recorded 31.3%. A similar finding was observed by Muhaidi (18), which recorded a morbidity rate of 36% in different ages from Al-Diwaniyah (19). In Duhok Governorate, the morbidity rate was 30% in lambs aged 2-4 months.
The results showed that SPV infection reached 32 %. This means that the studied area is endemic to SPV infection, which agrees with other researchers Muhaidi and Zangana (18,19) who found that the viral dissemination in the environment, the management system of the herd, and the host's immune status are the main reasons for SPV endemicity. Moreover, pox viruses have developed several pathways to overcome innate and acquired host immunity.
This occurs by encoding numerous immunomodulatory proteins, including interferons, chemokines, and cytokines (20). The sequence results showed a high level of similarity, showing that the sequences were identical and offering a greater degree of trust. Special primers were used to achieve the objectives of this study. A partial area of the SPV IFN-γ, GPCR, and MHC class 2 genes was used to suspect clinical cases with numerous skin lesions. These findings are consistent with earlier studies, as the GPCR gene had been used to diagnose LSDV disease in Thailand (21), Egypt (22), and Uganda (23), as well as other African and Asian countries (24). Characterization of the MHC class 2 encoded gene was well-studied in India and Jordan to demonstrate its pivotal role in host immunity against infections (25,26).
Previous studies in China focused on molecular diagnostics of the IFN-γ gene in ducks, geese, and sheep (27,28). An efficient evading strategy was demonstrated in many viruses, such as herpesviruses and poxviruses (19). Finally, PCR is an ideal technique to detect a wide range of viral infections and demonstrate their pathogenesis (30-40).
Conclusion
This study concludes that SPV strains in Iraq exhibited a substantial similarity with strains worldwide and in neighboring countries, with some genetic development to evade host immunity. Sequencing of these host-evading viral genes could help researchers further analyze SPV regarding viral quantification using the currently designed primers. It would also provide efficient information for epidemiologists and veterinarians.
Acknowledgments
We would like to thank the owners and all of the employees of the molecular diagnostic lab for their assistance and participation in the case and fact collection for this research.
Conflict of interests
The authors have no conflict of interest about the findings of this study.