Introduction
Several diseases can lead to the outbreak of anemia. Haemonchosis is one of these diseases that cause anemia caused by the parasitic nematode H. contortus. H. contortus is a parasitic nematode classified in the Phylum Nematoda, Class Secernentea, Order Strongylida, and Family Trichonstrongylidae. H. contortus is a species adapted to thrive in various climatic zones, especially where the weather is warm and humid, especially in areas with high levels of rainfall (1-5). Historically, haemonchosis was acknowledged to occur in established fit and reference zones. Still, climate change (i.e., the warming of areas that were previously not considered to be high-risk) has seemingly allowed H. contortus to survive and develop in zones that were supposed to be low-risk. Therefore, it is advisable for veterinarians and producers not only to consider haemonchosis when confronted with a case of anemia or mortality of sheep in so-called high-risk areas but also in low-risk or anywhere in between zones (6-10). If H. contortus remains in moist, warm conditions (above 12ºC) for 7-10 days, it completes its embryonic development. If conditions remain satisfactory for longer, the free-living larvae will progress through increased developmental stages, up to the fourth. Haemonchosis can occur throughout the year if the needed conditions are met. An example of the impact of climate on the potential for disease caused by H. contortus is that the maximal prevalence of this disease was recorded in the tropical zones located at 23.5º latitudes of North and South (11-13). The tropics are regions between 23.5º N and 23.5º S latitudes. These parts of the earth are considered tropical because they remain hot and humid all year round. In these tropical regions, climatic conditions favor the survival of H. contortus. They are associated with areas with the highest disease prevalence worldwide, such as Southeast Asia, India, and Africa. Haemonchosis is uncommon in drier parts of the world, i.e., regions where sufficient moisture is not present to support the independent larval phases of H. contortus, but this can change with increasing precipitation or irrigation, promoting the survival of H. contortus in hotter, drier regions (14-17). H. contortus eggs hatch best between 22 and 26ºC when humidity is close to 100% in the microclimate of the vegetation. Larvae can survive in dried feces in the harsh climate of deserts and emerge following the rain. As a consequence, a higher infection rate emerges suddenly after rainfall. In optimal environmental conditions, the development of H. contortus from egg to a third-stage larva (L3) can be completed within four days (18-20).
β-tubulin protein is essential to parasitic resistance against widely used anthelmint drugs, such as Benzimidazole derivatives, such as albendazole and mebendazole. The present study was carried out to identify and examine the genetic evolution of the β-tubulin gene, responsible for the synthesis of β-tubulin protein in H. contortus in sheep.
Materials and methods
Ethical approve
All the authors of the present work ensure that all procedures of our experiment were performed under the Ethical Norms approved by the scientific board of the College of Veterinary Medicine, University of Al-Qadisiyah (committee approval number 2111 on 16/10/2023).
Samples and microscopic examination
The present study was carried out to identify and examine the genetic evolution of the β-tubulin gene, responsible for the synthesis of β-tubulin protein in H. contortus in sheep. Here, 250 slaughtered sheep were explored, and 21 nematodes were collected and utilized in microscopic (10 nematodes) and 11 nematodes for molecular (PCR and sequencing) methods. The study collection of samples was done from October 2023 to February 2024. The samples were placed in lactophenol-included containers for microscopic examination. Other parts of the nematodes were placed in 70% ethanol for molecular tests. Each worm was placed on a glass slide and explored under a light microscope with magnification power at 10X.
DNA extraction and PCR
The DNA from the worms was extracted using the protocol and the kit AddBio (Korea). The PCR primers were collected from Zongze et al. (21). These are F: GGAACAATGGACTCTGTTCG and R: GAATCGAAGGCAGGTCGT. The 20 µl reaction volume contained the master mix at 10 µl, each direction of the primers at (0.5 pmol/20 µl) at 2 µl, PCR water at 4 µl, and DNA at 2 µl. The conditions for the PCR thermal cycler were one starting denaturing step, 40 steps (principal denaturing step, annealing step, and principal extension step), and one ending extension step at 95ºC, (95ºC, 55ºC, and 72ºC), and 72ºC for 5 mins, (35 s, 30 s, and 30 s), and 5 mins. The electrophoresis was run through a 1.5 agarose gel at 100 volts and 80 AM for 60 s. A gel documentation system was employed to visualize the PCR products.
β-tubulin gene partial sequencing
The PCR-positive products were sequenced at Macrogen Company in Korea. The NCBI websites and MEGA X software were utilized to analyze the sequencing data and produce the phylogenetic tree.
Results
The microscopic detection demonstrated the worm's positive identification. The results revealed the amplification of the gene region in 11 worms. These samples were amplified at 785 bp of length. Figure 1 shows these positive PCR products and their positive amplification bands.
Figure 1: Image of 1.5% Agarose gel electrophoresis of PCR targeting the β-tubulin gene of Haemonchus contortus in sheep. M: Ladder, 1-11: Positive bands at 785 bp, and NC: Negative control.
The sequencing of the nematodes identified ten isolates that are closely similar to isolates from Sweden, with a similarity rate of up to 98%. These sequences were PP393524, PP393525, PP393526, PP393527, PP393528, PP393529, PP393530, PP393531, PP393532, and PP393533 as they appeared in the GeneBank depository system (Table 1 and Figure 2).
Table 1: Comparison between the current study isolates and world isolates of Haemonchus contortus in sheep
|
Accession number
|
GenBank Accession number
|
Country
|
Identity (%)
|
|
PP393524
|
MK382798
|
Sweden
|
98.85
|
|
PP393525
|
MK382800
|
Sweden
|
96.08
|
|
PP393526
|
MK382797
|
Sweden
|
95.11
|
|
PP393527
|
MK382761
|
Sweden
|
95.92
|
|
PP393528
|
KF483614
|
Canada
|
95.92
|
|
PP393529
|
DQ469245
|
Switzerland
|
94.61
|
|
PP393530
|
MK382772
|
Sweden
|
95.42
|
|
PP393531
|
MK382788
|
Sweden
|
95.62
|
|
PP393532
|
KX246652
|
USA
|
94.60
|
|
PP393533
|
X80046
|
Netherlands
|
94.60
|
Figure 2: Phylogenetic tree comparing the current study isolates and world isolates from GeneBank based on the sequencing of the β-tubulin gene of Haemonchus contortus in sheep
Discussion
The current study was focused on detecting the resistance gene β-tubulin using PCR and sequencing. The results detected a wide genetic diversity and a high degree of population with demographic implications. For the phylogenetic analyses, identical and evolutionary relationships demonstrated a close similarity between the current study isolates and some isolates deposited in the GeneBank, such as those from Sweden (22-26).
These results suggest the parasite is active in transmission between countries and continents. The higher genetic similarity between spatially distinct populations may indicate shared ancestry or recent genetic exchange between Iraqi and Swedish isolates. In addition, livestock trade and the movement of migratory wild ruminants may play a major role in such transmission. The findings of the current study revealed that molecular methods are potential tools for better understanding the epidemiology and evolutionary dynamics of parasitic infections (26-31).
These results reinforce the need for international collaboration in monitoring and controlling parasitic infections since the genetic relationships of H. contortus populations can inform targeted interventions to limit the spread of this economically important parasite. Additionally, comparative genomic approaches might identify conserved genomic regions or common selective pressures shaping the evolution of H. contortus populations globally (32-37). The PCR results agreed with Roeber et al. (38), who reported detecting gastrointestinal nematodes in small ruminants (39,40).
Alubadi and Alfatlawi (41) reported the presence of H. contortus in 49/63 (77.8%) in Al-Diwaniyah City. Amana and Alkhaled (42) found that the parasite has diverse chromosome characterization of heterozygous at 31.11%, homozygous at 57.77%, and homozygous, which is a resistant genotype, at 11.11%. Moreover, Kandil et al. (43) found that condensed tannins, a Medicago sativa seed extract on H. contortus, were effective against the parasite in vitro and in vivo by fecal egg count reduction test (FECRT). In addition, Shehab and Hassan (44) found that albendazole, Levamisole, Oxyclozanide, and Ivermectin were effective against GIT nematodes at 84, 87, and 95%, respectively, as detected using FECRT. Furthermore, Hade et al. (45) found that their isolates were closely similar to isolates from Germany, New Zealand, and Austria at 94, 94, and 93%, respectively. Hadree et al. (46) investigated GIT parasites in buffalos and found that Nematodes, Cestode, and Trematode were at 85%, 10%, and 5%, respectively. Duly et al. (47) mentioned that microtubules are essential in different cell machinery, such as transport, motility, and mitosis.
Conclusion
The data reveals essential information about this gene's genetic evolution and presents critical data about drug resistance development in the current study isolates of Haemonchus contortus.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady, Dean of the College of Veterinary Medicine at the University of Al-Qadisiyah, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, financing agencies, or elsewhere to conduct this study.