Introduction
The agent of Anaplasma platys (Ehrlichia platys) is a tick-borne bacterium that infects mainly dogs and causes Infectious Canine Cyclic Thrombocytopenia (ICCT). This organism has a tropism for platelets and may disrupt these cells. However, the disease usually could be asymptomatic or subclinical in animals; however, it may show inappetence, weakness, emaciation, lethargy, and anemia in infected dogs (1,2). Hard ticks of the Ixodidae family are the primary transmitters for this pathogen. A. platys may infect other animals (such as cats, sheep, goats, and camels) with different prevalences worldwide (3). Tick-borne diseases pose a significant risk to human and animal health worldwide, as tick vectors could maintain a variety of pathogens, such as protozoal, bacterial, and viral. Many human infections with A. platys have been reported, reflecting its zoonotic potential (4,5). The prevalence rate of A. platys in dogs varies according to the region, presence of vectors, breed, and the type of diagnostic tools applied (such as serology, blood smear, and PCR). A. platys was previously identified in dogs from the United States in 1978 (6). Although the direct microscopic examination could reveal the presence of A. platys in a blood smear, this method has a low sensitivity in detection, especially in chronic cases and/or any cases characterized by low bacteremia (7). Several serological techniques, such as ELISA, indirect fluorescent antibody tests, and other available test kits, have been developed to detect animal Anaplasmosis. Cross-reaction with other members of Anaplasmataceae could be a significant drawback for serological detection (8,9). With the advancement of molecular techniques, many are used to detect pathogens. Those tools are usually robust, susceptible, and accurate methods mainly used for species identification based on their specific identified genes, such as gltA, groESL, and 16S ribosomal RNA (10,11). The susceptibility of dogs to infection with A. platys might have a substantial role in the epidemiology and transmission of this agent to other animals and/or humans. As companion animals to humans, dogs threaten public health by transmitting infectious agents, especially tick-borne organisms, such as Lyme borreliosis, Rickettsiosis, and Anaplasmosis (12,13). The latter has been reported as a human pathogen in the United States (14), and human infections have increased during the last two decades, according to the Centers for Disease Control and Prevention (CDC).
Therefore, Anaplasma species are considered an essential pathogen with many host preferences. Therefore, this scientific study aimed to investigate the presence of A. platys infection in dogs in Nineveh province, Iraq.
Material and methods
Ethical approval
The study has been approved under the title code (UM.VET.2022.081) by the scientific research committee of the College of Veterinary Medicine, University of Mosul, Mosul, Iraq.
Animals and samples collection
The study examined 81 dogs; part of those samples was retrieved from the Veterinary Teaching Clinic of the College of Veterinary Medicine, University of Mosul, Iraq, and the others were from private veterinary stations in Nineveh province. The clinical examinations were applied to all animals. From March 2023 till November 2023, the blood samples were collected from the cephalic vein in dogs via the vacutainer tubes, and thin blood smears were made and stained with Giemsa stain for direct microscopic examination (15).
Microscopic examination of blood smears
In this topic, stained blood smears were prepared and examined under a light microscope (100X Oil immersion lens) to detect A. platys inclusion bodies within platelets.
PCR and sequencing
DNA was extracted from the EDTA-processed blood samples using a commercial extraction kit (Roche Ltd., Switzerland). Then, DNA concentration was evaluated with the aid of Nanodrop (Biochrom, UK). The polymerase chain reaction (PCR) was applied for all included samples (n=81) to confirm the results of direct microscopic findings. The gltA gene (a citrate synthase-responsible gene) was used as a molecular marker for detecting A. platys in DNA samples. For this purpose, the primers targeted by this gene in the current study were used (16), which included (Forward primer: ATGCTGTTTTGATGTGCGGG and reverse primer: CCGCACGGTCGCTGTT); these primers were provided by Macrogen Company, which is located in South Korea. The PCR conditions were as follows: initial denaturation at 95°C for 2 min, then 95°C for 30 s with 40 cycles for denaturation, annealing at 58°C for 30 s, followed by 72°C for 30 s for the extension, and the reaction was ended at 72°C for 5 min for a final extension step. The PCR products were visualized after running on 1% agarose via a UV transillumination system (Chemi-Doc System, Carlsbad, USA). Following checking the appropriate band size, the PCR products with forward primer were sent for sequencing by the Sanger method (Macrogen Co., South Korea). By aligning the recovered sequences with other strains listed on the NCBI website, the local A. platys sequences were identified. Moreover, the sequence of the gltA gene for the obtained strain of A. platys was deposited in the NCBI GenBank database. A neighbor-joining approach was selected for constructing a phylogenetic tree using Mega-11 software.
Results
The current work revealed that the overall infection rate of A. platys in dogs in Nineveh province was 6/81 (7.40%) based on the findings of microscopic examination (ME) of the blood films, and it was 11/81 (13.6%) with PCR technique. The clinical examination of suspected dogs showed loss of appetite, fever (39.5°C - 40°C), depression, weakness, pale mucus membranes, petechial hemorrhage on different parts of the body, nasal discharges, and coughing. However, some suspected dogs showed only signs of anemia, such as weakness and/or paleness of mucus membranes.
In this study, the infection rate of A. platys was 8.0% and 14.0% in stray dogs, whereas in household dogs, its prevalence was 6.45% and 12.9 %, according to the findings of ME and PCR techniques, respectively. Although more positive animals were detected in the stray dogs group, no significant statistical difference was observed between the two groups. The results based on the ME of 81 thin blood smears showed the presence of inclusion bodies of A. platys inside the platelets (Figure 1). In molecular analysis, the concentration and purity of the obtained DNA ranged between 55.3 - 285.9 ng/µl and between 1.8-1.9, respectively. In addition, the PCR screening for 81 DNA samples revealed the presence of amplified fragments of gltA gene with a band size in approximately 690 bp (Figure 2).
Figure 1: A blood smear stained with Giemsa stain showed inclusion bodies (morulae) of A. platys in platelets of an infected dog, examined under a light microscope with an oil immersion at (1000X).
Figure 2: PCR amplicons loaded on 1% agarose gel. Lane M: DNA ladder 100-3000bp; Lane P: A positive control for A. platys (DNA sample from an infected dog); Lanes (2, 3, 4, 8, 9, and 13) showed the expected band size of about 690 bp; Lane N: considered as negative control.
By comparing the retrieved local sequence OR194151.1 of the gltA gene of A. platys genotype to the available database in GenBank, it was possible to show that the local sequence was closely related 100% identity to those of Argentine MN725733.1, France AB058782.1, Thailand OP270645.1, China KR011928.1, Philippines JN121381.1, Italy DQ525687.1, Spain AY530807.1, and Brazil EU516387.1, as shown in (Tables 1 and 2).
Table 1: The nucleotide sequence of gltA gene for the local Anaplasma platys isolate WSHM1
|
Local genotype
|
Gene
|
Sequence
|
Accession No.
|
|
WSHM1
|
gltA
|
ACTGATGGGATACAATTGATAGACATCACTACGTTGTACAGAGACCATAAGGTCTTGACCTACGATCCGGGATTCATGTCTACCGCGGCATGCAGCTCTGAGATAACCTTTATCGACGGAGAAAAGGGTATACTGCGCCACCGCGGGCTTGACATTGCAGACCTAATAGGAATTAAAGGTGGCTTTTGTAGTGTGGCCCATTTACTGCTCTATGGGGTTTTGCCATCAGACACAGTGTTCGAGCAATTTTCGGCAGCTATAGGGGCGCAGCATGCTCTGTCATCCGACGTTTTAGGCGTGATTTCATCCTTCAGGAGAGATGCTCATCCCATGGCAATATTGATGGCATGCTTTTCAACTTTGGCTGCGAAGTATCATGGGGATAATAGGGGAAATGAAGAGC
|
OR194151.1
|
Table 2: Similarities between the local strain of Anaplasma platys (OR194151.1) and other genotypes on the GenBank
|
Name of strains
|
GenBank
|
Query
|
Sequence
|
Country
|
|
A. platys isolate CA citrate synthase (gltA) gene
|
MN725733.1
|
100%
|
403/403 (100%)
|
Argentine
|
|
A. platys RDC citrate synthase (gltA) gene
|
AF478130.1
|
100%
|
403/403 (100%)
|
Congo
|
|
A. platys isolate AG049-Saraburi citrate synthase (gltA) gene
|
OP270645.1
|
100%
|
402/403 (99.75%)
|
Thailand
|
|
A. platys isolate WSti2f citrate synthase (gltA) gene
|
KR011928.1
|
100%
|
402/403 (99.75%)
|
China
|
|
A. platys isolate DSE citrate synthase (gltA) gene
|
JN121381.1
|
100%
|
402/403 (99.75%)
|
Philippines
|
|
A. platys strain Dog 4 Sicily citrate synthase (gltA) gene
|
DQ525687.1
|
100%
|
402/403 (99.75%)
|
Italy
|
|
A.platys citrate synthase (gltA) gene
|
AY530807.1
|
100%
|
402/403 (99.75%)
|
Spain
|
|
A. platys (gltA) gene for citrate synthase
|
AB058782.1
|
100%
|
402/403 (99.75%)
|
France
|
|
A. platys strain RP citrate synthase (gltA) gene
|
EU516387.1
|
100%
|
400/403 (99.50%)
|
Brazil
|
Furthermore, the analysis of a phylogenetic tree using the maximum likelihood method in MEGA-11 software revealed that the local sequences of A. platys were closely related 99.50 - 100% identity to those available strains of A. platys in the GenBank database. The tree was rooted with Anaplasma phagocytophilum GQ412342.1/China, regarded as an outgroup (Figure 3).
Figure 3: Phylogenetic hierarchy, built by the Tamura-Nei model using the Maximum Likelihood approach, of the partial sequence of gltA gene for the local isolate of A. platys. The bootstrap analysis with 1000 replications was used. This tree was used Anaplasma phagocytophilum (GQ412342.), China as an outgroup.
Discussion
The tick-borne infection caused by A. platys is prevalent in tropical and subtropical areas. With the expansion of tick vectors due to climate change, the risk of introducing pathogens into new regions is potentially high. In this study, A. platys was reported for the first time in the northern part of Iraq. The microscopic examination of blood smears has a low sensitivity in detecting A. platys. However, it is a quick and cheap method used routinely in laboratory diagnosis (7,17). The difficulties in examining blood film due to misleading artifacts, nuclear debris, and/or cytoplasmic aggregations may require validating the microscopic findings with more specific diagnostic tools such as serological tests and/or molecular methods such as PCR (18). The serological tests may indicate exposure to pathogens, whereas molecular tools could be more robust regarding diagnostic sensitivity and specificity (19-21). Moreover, the serological assays could result in false positive findings from cross-reaction with other genotypes (9,22).
The phylogenetic tree of the local sequences of A. platys revealed that they share common phylogenetic characteristics and have a very tight evolutionary relationship with the other sequences of A. platys that have been submitted to the NCBI GenBank from different resources including Argentine (23), Congo (24), Thailand (25), China (26), Philippines (27), Italy (10), Spain (28), France (29), and Brazil (30) with the 99.5-100% identity. The Bootstrap analysis created the ancestor tree based on 1000 re-sampling and the Likelihood method on the Tamura-Nei model by MEGA-11 software (31,32).
According to the molecular investigation in tested samples, the current study found that the total infection rate of A. platys was 13.6%. On the other hand, the microscopic findings showed an infection rate of 7.4% in examined dogs. The molecular technique is susceptible to detecting the presence of A. platys, and it can effectively identify the species. However, the microscopic examination is considered a gold standard test for morphological examination of those agents, but it has less value in detecting them during low bacteremia phases and/or in persistently infected cases (33,34).
Regarding the PCR screening, the study outcome was higher than the reported prevalence rate of 3.33% in the examined dogs in Baghdad city (35) since a different number of targeted samples and different geographical areas might affect this observation. In some neighboring countries, it was reported as 6% in Turkey (36) and 3.7% in Iran (37). The prevalence rate in Egypt was 6.4% (38), whereas it was 5.5% in Algeria (39). Moreover, it showed 7.0% in Thailand (40), in Paraguay 10.67% (41), and in the Caribbean area it was 18.7% (42). The differences in the infection rate with A. platys in dogs may be attributed to climate conditions, sample size, abundance of ticks, vector control, different applied screening tests, and mode of living, i.e., stray and/or pet animals.
Conclusion
To our knowledge, this investigation reported the detection of A. platys in dogs for the first time in northern Iraq. It was preliminarily verified by microscopic evaluation of blood smears and then PCR and DNA sequencing (Molecular techniques). This report may enhance further epidemiological studies of that bacterial agent in different animal species in Iraq in future studies.
Acknowledgement
The authors appreciate the College of Veterinary Medicine, University of Mosul, Mosul, Iraq, for collaborating in finalizing this scientific work.
Conflict of interest
There is no competing interest, as stated by the authors.