Introduction
Goats (Capra aegagrus hircus) are the most important species of food animals that have a unique capacity to adapt to harsh situations with multiple economically relevant traits such as short reproduction cycles, higher rates of reproduction and high consumer acceptability worldwide, there are nearly 1 billion goats (1,2). In Iraq, the goat farming sector plays an essential role to the nation's food security. There have been an estimated 1.5-2.0 million goats dispersed across the nation, with 2.5% in the south, 44.2% in the center, and 43.3% in the north, providing a vital source of meat and milk production (3). According to historical records, the two distinct Iraqi traditional goat breeds are Black (Native or Rashoky) and Meriz goats (4,5). The small ruminant industry in Iraq has a considerable challenge provided by the challenging animal disease circumstances (4,6). Thieleriosis is a blood parasitic disease of domestic and wild ruminants caused by the parasite’s apicomplexan (Apicomplexan parasites) of the genus Theileria. This parasite is protozoa are obligate parasites living inside erythrocytes and lymphocytes (7), and transmitted through by ixodid tick species related to the genera (Hyalomma, Haemaphysalis, and Rhipicephalus) and have complex life cycles in both vertebrates and invertebrates (8). It represents a significant pathogenic condition affecting both small and large ruminants, manifesting in acute, subacute, or chronic forms (9,10). Thieleriosis causes significant economic losses in goats because to high mortality and morbidity rates (11). Caprine theileriosis (CT) can be caused by a minimum of six different species of Theileria (T. luwenshuni, T. lestoquardi, T. uilenbergi, T. ovis, T. separata, and T. recondite). the three species are T. luwenshuni, T. lestoquardi and T. uilenbergi are all extremely virulent goat species (12,13). The disease in small ruminants results in a significant morbidity rate of up to 100% and a fatality rate of more than 46%, which is a very high percentage (14). They may include fever, loss of appetite, weight loss, lymphadenopathy (15), respiratory signs (cough, nasal discharge, shortness of breath) (6,16), anemia, jaundice, diarrhea. Reproductive losses including abortion can be seen (17). Various laboratory techniques are employed for diagnosing the disease. The direct microscopic examination of parasites in blood smears, dyed with Giemsa stain, only useful during the acute stage of infection. However, it proves unsatisfactory for diagnosing carrier animals and is impractical on a large scale (18,19). In contrast, serological testing is indicated as the best technique of diagnosis during the latent stage of disease and in epidemiological studies. It is essential to highlight that serological evaluations do not distinguish between recent and old infections (20). Later, multiple reliable diagnostic molecular tools, such as conventional polymerase chain reaction (c-PCR), multiplex (m-PCR), nested (n-PCR), and real-time (r-PCR) (21,22), have been established for the direct detection of haemoprotozoan infections. These PCR assays are considered reliable diagnostic tools and are advised to detect latent infections. Additionally, they may be used to assess genetic diversity and evolutionary relationships among emerging haemoprotozoan species (23,24).
Notably, there has been no prior study on the occurrence of theileriosis infection in caprine in Erbil governorate, north Iraq. Consequently, the present study aims to assess the detection of caprine theileriosis using direct microscopic examination and molecular tools. It also aims to document the phylogenetic diversity of theileriosis among different caprine species based on 18S rRNA sequences. This study represents the first exploration of these aspects in the Erbil of Iraq.
Material and methods
Ethical approval
The study was carried out in compliance with the ethical norms provided by the Institutional Animal Care and Use Committee at Mosul University's College of Veterinary Medicine, and all samples were gathered with owner agreement under the approved of 10th congress of Department of Microbiology at 11/6/2023.
Sample collection
A total of 150 samples from diverse goat breeds, spanning various ages and both genders, were randomly collected between July 7, 2023, and October 20, 2023, in Erbil governorate, Iraq. These samples were examined to confirm the presence of caprine theileriosis infection.
Clinical examination of animals
A thorough clinical examination, including assessment of temperature, mucous membrane condition, lymph nodes, heart rate, and respiration, was performed on all potentially affected animals.
Hematological examination
Blood samples were collected from the jugular vein using a 5 ml disposable syringe with an 18-gauge needle, and they were collected in 2.5 ml tubes containing EDTA. Subsequently, smears were prepared, air-drying, fixed in absolute methanol for five minutes, and stained with ten percent Giemsa for a thirty-minute period to identify the presence of parasites in erythrocytes (25). The slides underwent examination using an oil immersion lens at a power of ×1000 to detect Theileria parasites. All the remaining blood samples have been kept at -20 °C for subsequent DNA extraction.
Molecular examination and processing
The Prime PrepTM DNA Genome Extraction Kit from Genet Bio in South Korea (SK) was employed to extract genomic material from 150 goat blood samples, following the manufacturer's instructions. Subsequently, two amplification reactions were carried out to target the 18S rRNA gene of Theileria spp. The first reaction, utilizing the c-PCR technique, aimed to identify positive sheep for all Theileria spp. using universal primers (989-F AGTTTCTGACCTATCAG and 990-R TTGCCTTAAACTTCCTTG), resulting in an approximate band size of 1098bp. The second reaction, employing the m-PCR technique, aimed to differentiate T. ovis in all positive samples from the first reaction, utilizing specific primers (T170-F TCGAGACCTTCGGGT and T670-R TCCGGACATTGTAAAACAAA) for T. ovis, yielding an approximate band size of 520bp. All primers used were supplied by Macrogen Inc., South Korea.
In brief, a 25 µl mixture, add 2 µl of target DNA, 1 µl (10 pmol) for every of the reverse primers (990-R) for Theileria, 2 µl of a common forwarding primer (989-F), 6.5 dH2O, and 12.5 µl of ready-to-use 2X PCR master-mix (GeNet Bio. Laboratory, Korea). The mixes were cycled using a BioRad thermocycler, which included an initial denaturing phase at 96ºC for 10 min., followed by 35 cycles of denaturing at 96ºC for 1 min., annealing at 54ºC for 1 min., and extension at 72ºC for 1 min. The procedure was completed with a 10-minute extension at 72ºC. The products were then kept at 4ºC for future analysis.
Following the process of amplification, gel separation was carried out in a 1.5% agarose gel, with 1X TBE buffer. The amplificons (5 µl) were run for 45 minutes and examined under UV illumination (Proxima 2500 Isogene LifeScience, Netherlands), revealing distinct bands of Theileria (1098 bp). Positive controls for Theileria species have been obtained from the blood of infected goats with verified clinical theileriosis, whereas negative controls were derived from piroplasm-free goat DNA. Furthermore, the second reaction utilizing T. ovis-specific primers (T170-F and T670-R) produced DNA bands 520 bp, confirming the samples' positive for T. ovis.
Statistical analysis
The present study's data was analyzed using Chi-square with a P<0.05 (10).
Results
Clinical hematological detection of Theileriosis
The overall infection rate of caprine theileriosis, determined through Giemsa-stained blood smears and c-PCR technique among 150 samples, was 29.3% (44/150) and 65.3% (98/150), respectively. The identification of Theileria species was based on the morphological characteristcs of the merozoites observed in infected red blood cells (RBCs). Notably, typical Theileria spp exhibited a small parasite morphology characterized by a single round or double pyriform shape with acute or obtuse angles. Additionally, these parasites manifested various morphological configurations within RBCs, including oval, anaplasmoid, spherical, and single or double pear shapes. The double pear shape was particularly prominent, as illustrated in figure 1. The major observations found in clinically infected goats were suffered from dull, depressed, fever, increased respiratory rate, anorexia, pale conjunctival mucous membrane, lethargy, the goat had rough hairy skin and coat with tick infestations. cough and nasal discharge, enlargement of prescapular lymph nodes as shown in (Table 1). In this present study, the detection of Theileria spp. did not exhibit a significant difference concerning the gender and age of goats. Female and male goats showed infection rates of 32.9% (27/82) and 25% (17/68), respectively, with no statistically significant distinction (P≤ 0.05). A higher infection rate with caprine theileriosis was observed in the age group exceeding 5 years, reaching 32% (13/44), in comparison to the other two groups, with no significant differences (Tables 2 and 3). In the current study, the incidence of theileriosis in caprine populations revealed that imported goats had the highest infection rate 50% with significant differences, followed by imported black goats 27.3%, and Merzi goats 21.4% (Table 4).
Figure 1: Displays a Giemsa-stained blood smear, where A) reveals multiple blood cells infected with Theileria spp., exhibiting double pear shapes with acute and obtuse angles, single pear shapes, and round configurations. B) Theileria spp. Are depicted with a pyriform shape (a pair of joints), observed at a magnification of x1000.
Table 1: Clinical signs of infected goats with theileriosis
|
Clinical signs
|
Infected n (%)
|
|
Fever
|
52 (86.6)
|
|
Dehydration
|
22 (36.6)
|
|
Anorexia
|
31 (51.6)
|
|
Yellowish soft diarrhea
|
18 (30.0)
|
|
Pale mucous mm.
|
42 (70.0)
|
|
Edema
|
7 (11.6)
|
|
Respiratory signs
|
37 (61.6)
|
|
Swelling of prescapular lymph node
|
45 (75.0)
|
Table 2: Sex detection of Theileriosis in goats
|
Factor
|
Total (n)
|
No positive (%)
|
P value
|
|
Female
|
82
|
27 (32.9)
|
0.29
|
|
Male
|
68
|
17 (25.0)
|
Table 3: Aage-wise detection of Theileriosis in goats
|
Factor
|
Total (n)
|
No positive (%)
|
P value
|
|
<1 year
|
32
|
8 (25.0)
|
0.78
|
|
1—5 years
|
78
|
23 (29.5)
|
|
>5 years
|
40
|
13 (32.5)
|
Table 4: The prevalence of Theileria species in goats according to the breeds
|
Factor
|
Examined (n)
|
No positive (%)
|
P value
|
|
Merzi
|
42
|
9 (21.4)
|
0.41
|
|
Black
|
84
|
23 (27.3)
|
|
Imported
|
24
|
12 (50.0)
|
|
Total
|
150
|
44 (29.3)
|
|
Molecular detection of Thieleria species using PCR
The outcomes of the amplified PCR product using general or universal primers (Macrogen Inc, South Korea) revealed that the DNA band size for the initial reaction was 1098 bp, indicating a positive presence of Theileria spp. (Figure 2). In contrast, the second reaction using specific primers for T. ovis displayed a DNA band size of 520 bp, signifying a positive detection of T. ovis (Figures 3). The findings indicated that 44 goats, constituting 29.3% of the sample, were positive by microscopical examination. Notably, all goats that tested positive through microscopic examination were also confirmed as positive through PCR. These results provide insights into the detection of Theileria catch-all in goats, using numerous criteria that describe both the features of the animals and the flocks.
Phylogenetic trees of 18S rRNA sequences analyses based on neighbor-joining program have shown in figures 4 showed that Theileria spp. have a relation to Theileria ovis. The three sequences were blasted with prior GenBank registration, and found that OR854546 showed 99.54% identity with MN544931/Sheep/Sulaimani-Iraq, While OR854547 showed 99.44% identity with KT851437/ Hyalomma excavatum/ Turkey, AY260172 /Sheep/Turkey. Moreover, sequences OR854548 were 98.15% identity to those sequenes previously published T. ovis in NCBI GenBank for Turkey (OR652382/ Canis lupus familiaris, KT851436/ Rhipicephalus bursa) and China (FJ603460/ Sheep).
Figure 2: Gel electrophoresis image showing; PCR detection of Theileria spp. with a pair of universal primers ((Macrogen Inc, South Korea): Lanes L) 100 bp ladder DNA marker; Lane 1,2,4,5,6) Theileria spp. in approximately band size 1098 bp; lane 3 and 7) negative control.
Figure 3: The gel- electrophoresis picture shows; PCR detection of T. ovis. with a pair of specific primers (Macrogen Inc, South Korea): Lanes L) 100 bp ladder DNA marker; Lane 2-7 T. ovis. in approximately band size 520 bp; lane 1) negative control.
Figures 4: Phylogenetic tree of 18S rRNA T. ovis partial sequences by maximum likelihood. The black diamond indicates sequences derived from the present investigation; the others reflect sequences from Genbank.
Discussion
Caprine theileriosis has been reported previously in Iraq by a variety of direct and indirect approaches, such as Giemsa-stained blood smears (26,27). However, these methods are primarily suitable for detecting infections during the acute stage and may not effectively identify presymptomatic or carrier animals with low parasitemia (28,29). Thus, the purpose of this study is to assess the incidence of Theileria infection in several goat species from Erbil region, North Iraq, employing both blood smears and molecular techniques. Additionally, it seeks to document the phylogenetic sequencing of c-PCR products for the first time.
In the current investigation, the infection rate was 29.3% (44/150) and 65.3% (98/150) by Giemsa-stained blood smears and the conventional PCR technique, respectively. The lower infection rate observed through microscopic methods is attributed to their limited sensitivity and specificity, particularly in detecting infections during the latent or carrier stage with low parasitemia (30,31).
Molecular techniques, known for their high sensitivity and specificity, have been widely employed for detecting and differentiating caprine theileriosis, particularly in carrier animals (32). In this study, molecular study of goat blood samples from several regions in Erbil governorate, Iraq, revealed that 29.3% (44/150) of clinical goats were infected with Theileria. Theileria spp. had an infection rate of 29.3%. The significantly high incidence identified in this study might be due to the extensive tick vector population. Previous studies in Duhok reported prevalence rates of 20.8% for Theileria species (33), and in Baghdad, infection rates were reported at 26.6% for Theileria species (34-36). Higher prevalence rates were noted in Sulaimani city 71.7% by PCR (37,38), and Mosul city 22.7% by microscopic examination and 52.4% by PCR (37).
The study found no significant differences within goat genders and age categories, suggesting that caprine theileriosis is widespread in Erbil. This could be attributed to physical stressors temporarily compromising the immune system, rendering animals more susceptible to infection (39). The study utilized the 18S rRNA gene for genetic identification and phylogenetic evaluation of caprine theileriosis (40), marking the first of its kind in the Erbil province. The research provides initial insights into the genetic variety of theileriosis in the goat herds of Iraq based on 18S-rRNA sequencing data. Despite six genotypes of Theileria previously identified in goat populations from various countries (41), the study's discovery of a new sequence from Erbil emphasizes the need for continued research to better understand the prevalence of the disease, especially considering unregulated animal trade with neighboring countries. PCR emerged as an important method in epidemiological research, allowing the identification of both carrier and diseased animals. Based to the molecular investigation, Theileria ovis is considered the main species infecting goats in Erbil city. Future studies on caprine theileriosis should focus on aspects related to the vector (ticks), aligning with findings from previous research (42-46).
Conclusion
The findings of this study indicate a notable infection rate of theileriosis, suggesting that the disease is endemic in Erbil city, possibly linked to unregulated animal trade with neighboring countries. During the last decade, there has been a significant increase in the imported of goats into the Erbil. These results underscore the need for the invention of additional diagnostic methods capable of identifying various genotypes of Theileria species in different animals, aiming to mitigate the risk associated with importing carrier goats. PCR emerged as an important method in epidemiological investigations, allowing the identification of both carriers and diseased animals. According to the molecular analysis, Theileria ovis is the main species infecting goats in Erbil city. Future studies on caprine theileriosis should concentrate on aspects related to the vector, particularly ticks.
Acknowledgments
I would like to thank the College of Veterinary Medicine/ University of Mosul for helping to support this effort.
Conflict of Interest
The researchers had no conflict of interest.