Introduction
- fluorescens represents a saprophytic nonpathogenic with poor nutritional requirements and great diversity enabling them to survive in different environments including utensils used in the dairy production chain (1,2). These bacteria cause dairy product spoilage through their ability to produce some exoenzymes mainly proteases and lipases (3,4). Sometimes pseudomonas counts aren’t indicative of the assessment of milk spoilage (5,6). Although some pseudomonas species become inactive after the thermal processing of milk like pasteurization their exoenzymes revealed high resistance to heat and affected milk shelf-life by casein and fat degradation (7,8). One of these enzymes is Alkaline zinc metalloprotease which consists of one zinc atom with eight atoms of calcium and a high molecular weight ranging between 21-25 kilodaltons their activity depends on the presence of calcium ions (9,10). AprX hydrolysez k-casein, para k-casein and beta-casein releasing plasmin and plasminogen which create unacceptable changes in milk (11). P. fluorescens produce lipolytic enzymes giving the rancid odor and flavor of dairy products (12,13). Lipases have a molecular mass between 30-50 KDa with optimum alkaline PH (14). The production of lipase is affected by the concentration and the type of nitrogen, iron and carbon whereas the presence of magnesium, zinc and iron decreases the activity of lipase (15,16). Molecular methods including polymerase chain reaction assay are used to monitor the impact of protease and lipase by detecting related genes represented by aprX and lip genes as spoilage indicators to evaluate milk quality (17). Local research studies the molecular features and antimicrobial sensitivity of different bacterial isolates in some dairy products including some Pseudomonas spp. especially P. aeruginosa (18-20).
A few of them investigate the impact of P. fluorescens exoenzymes on milk quality therefore this study aims to screen the presence of aprX and lip genes in P. fluorescens isolated from cow milk teat surfaces and milk tanks in dairy farms in Nineveh province.
Material and methods
Ethical approval
The research was conducted considering the ethical approval of the institutional Animal Care and Use Committee at the College of Veterinary Medicine, University of Mosul and included an authorized ID of UM.VET. 2023.102. Mosul, Iraq,2024.
Samples
The study included collecting one hundred fifty samples of cows' raw milk, teat surfaces swabs and milk tank swabs from Nineveh province dairy farms to detect the presence of P. fluorescens Thirty-nine positive isolates of P. fluorescens were distributed as 19,11, and 9 isolates from raw milk, teat surfaces and milk tanks respectively were examined to investigate their abilities to produce exoenzymes as spoilage indicators.
Isolation and identification
samples were cultivated on Cetrimide agar (Neogen/USA) incubated at 25°C for 24-48 hours then purified on Cetrimide agar and followed by biochemical tests (21). The P. fluorescens isolates were confirmed using a polymerase chain reaction depending on the16srRNA gene.
DNA extraction
- fluorescens colonies were subjected to DNA extraction depending on the bacterial DNA preparation kit (AddBio, Korea) following the manufacturer’s instruction protocol.
Polymerase chain reaction (PCR)
- fluorescens protease and lipase activity were investigated using PCR assay depending on the detecting aprX and lip genes respectively. A specific primer was provided by (Macrogen/Korea). The primer consists of forward and reverse primers (22) with a molecular weight of 1434 bp and 1422 bp to aprX and lip gene respectively (Table1). The thermal profile included an initial denaturation of 10 min. at 95ºC followed by 35 cycles of 95ºC for 45s, then annealing 58ºC, 55ºC for 45 sec. for aprX and lip gene respectively, extension at 72ºC for 1 min. and final extension of 72ºC for 5 min. with cooling at 4ºC. PCR products were analyzed by electrophoresis (1.5% agarose gel) (AddBio, Korea) with 3 μl GelRed dye (AddBio, Korea). 5 μl of each PCR product was loaded into the well of agarose gel. The electrophoresis was carried out at 75 volts for 1 hour. The band was identified using the Gel doc EZ image (Bio-Rad, USA).
Table 1: Oligonucleotide primers sequence of P. fluorescens exoenzymes genes used in the current study
|
Primers
|
Primer's sequence (5”-3”)
|
Tmemperature (ºC)
|
Product size (bp)
|
Reference
|
|
aprX-F
|
TTATGTCAAAAGTAAAAGAC
|
58
|
1434
|
22
|
|
aprX-R
|
TCAGGCTACGATGTCACTG
|
|
lip-F
|
ATGGGTRTSTTYGACTATAAAAACC
|
55
|
1422
|
22
|
|
lip-R
|
TTAACCGATCACAATCCCCTCC
|
Results
Results showed the detection of protease and lipase exoenzymes genes of P. fluorescens strains isolated from cow raw milk, teat surfaces and milk tanks including aprX and lip genes. The aprX gene was detected in 58.9% (23/39) of isolates. The highest rate of aprX genes prevalence was found in the P. fluorescens isolates from teat surfaces (9/11) which was 81.8% compared to isolates from raw milk (7/19) which was 36.8%. The lip gene was detected in 23.1% (9/39) of isolates. P. fluorescens isolates from milk tanks revealed a higher percentage of the presence of lip gene (3/9) at 33.3% followed by isolates from raw milk (5/19) at 26.3% compared to P. fluorescens isolates from teat surfaces (1/11) 9.1% (Table 2 and Figure 1). The aprX and lip genes were detected at 1434 bp and 1422 bp respectively as shown in (Figures 2 and 3).
Table 2: Detections of protease and lipase activity in milk, teat surfaces and milk tanks
|
P. fluorescens sources
|
No.
|
Protease activity aprX gene
|
Lipase activity lip gene
|
|
No.
|
%
|
No.
|
%
|
|
Milk
|
19
|
7
|
36.8
|
5
|
26.3
|
|
Teat Surfaces
|
11
|
9
|
81.8
|
1
|
9.1
|
|
Milk tanks
|
9
|
7
|
77.7
|
3
|
33.3
|
|
Total
|
39
|
23
|
58.9
|
9
|
23.1
|
Figure 1: Percentage of protease and lipase genes in P. fluorescens isolates from milk, teat surfaces, and milk tanks.
Figure 2: Amplified products of aprX gene of P. fluorescens, Lanes M represent 100 bp DNA marker, lane 1-2; negative samples, lane 3-11; positive samples at 1434 bp product size, lane 12; negative control.
Figure 3: Amplified products of lip gene of P. fluorescens, Lanes M represent 100 bp DNA marker; lanes 1, 2, 4, 5, 6, 11, 12, 13, 14, 15, 18; negative samples, lanes 3, 7, 8, 9, 10, 16, 17; positive samples at 1422 bp product size lane 19; negative control.
Discussion
- fluorescens is commonly isolated from soil, water and surfaces as a saprophytic bacterium (23,24) these species can secrete some enzymes including proteases and lipases exoenzymes and a number of these secreted enzymes depends on the P. fluorescens strain which highlighted the vast diversity of P. fluorescens isolates (25-27). aprX gene and lip gene were used as a marker to detect P. fluorescens protease and lipase activity in milk depending on PCR technique and distinguish proteolytic and lipolytic strains (28,29), to reduce the time for detecting P. fluorescens as deteriorating agents in raw milk and providing more flexible work to the dairy manager to assess milk quality (23,30). Therefore, PCR assay was used as a good and sensitive approach to detect the presence of protease and lipase enzymes as spoilage indicators to estimate the degradation of milk components including casein protein and lipids (31). The results of this study revealed the presence of the aprX gene in 36.8% of isolates from raw milk These results agree with the results obtained by De Longhi (32) who showed the presence of the aprX gene in 37% of P. fluorescens strains isolated from milk which indicates this bacterium’s presence in farm animals’ milking environments (33,34). aprX gene was observed in 71.2% of P. fluorescens isolates in bovine milk and the high presence of the aprX gene in cow raw milk is associated with sensory defects affecting the shelf life of milk (35). The presence of calcium is an essential factor for the potency and resistance of proteases (36,37). Also increased proteolytic activity in P. fluorescens may be related to the type of N-acyl homoserine lactone (AHL) either directly or indirectly (38). Although the lip gene was detected in raw milk and milk tank and teat surfaces their presence is at a lower limit than that of the aprX gene. These results disagree with Ribeiro (35) who revealed the lipolytic activity in 25% of P. fluorescens isolates from cow milk. In comparison the lipolytic activity of cow milk was evaluated in 9.3% of P. fluorescens isolates (39). It may be because protease was more resistant at a wide range of PH and temperatures (25,40,41) suggesting the adaptation of P. fluorescens strains to various environmental circumstances previous studies referred to the proteolytic activity of P. fluorescens in the late exponential and early stationary phase of growth (42-44). However, rapid and sensitive methods are essential to ensure product safety and perform risk assessment Preventive measures should be taken to reduce aprX biosynthesis in milk and dairy products.
Conclusion
Early detection of milk spoilage due to P. fluorescens is a significant predictive factor. This bacterium secretes exoenzymes represented by protease and lipase enzymes by identifying specific genes. Therefore, the activity of these exoenzymes is a limiting factor maintaining milk quality.
Acknowledgments
This research was supported using resources from the University of Mosul's College of Veterinary Medicine in Mosul, Iraq.
Conflict of interest
The authors confirm there was no conflict of interest.
|
- Ganeshan G, Kumar MA. Pseudomonas fluorescens, a potential bacterial antagonist to control plant diseases. J Plant Interact. 2005;1(3):123-134. DOI: 1080/17429140600907043
- Abdullah A, Esmael QA. Orientations of dairy producers and consumer attitudes (a field study in the province of Nineveh). Mesopotamia J Agric. 2018;46(4):109-120. DOI: 33899/magrj.2018.161538
- Quigley L, O’Sullivan O, Stanton C, Beresford TP, Ross R, Fitzgerald GF, Cotter PD. The complex microbiota of raw milk. FEMS Microbiol Rev. 2013;37:664-698. DOI: 1111/1574-6976.12030
- Chen L, Daniel RM, Coolbear T. Detection and impact of protease and lipase activities in milk and milk powders. Int Dairy J. 2003;13(4):255-275. DOI: 1016/S0958-6946(02)00171-1
- Von Neubeck M, Baur C, Krewinkel M, Stoeckel M, Kranz B, Stressler T, Fischer L, Hinrichs J, Scherer S, Wenning M. Biodiversity of refrigerated raw milk microbiota and their enzymatic spoilage potential. Int J Food Microbiol. 2015;211:57-65. DOI: 1016/j.ijfoodmicro. 2015.07.001
- Kumar H, Franzetti L, Kaushal A, Kumar D. Pseudomonas fluorescens a potential food spoiler and challenges and advances in its detection. Ann Microbiol. 2019;69:873-883. DOI: 1007/s13213-019-01501-7
- Caldera L, Franzetti L, Van Coillie E, De Vos P, Stragier P, De Block J, Heyndrickx M. Identification, enzymatic spoilage characterization and proteolytic activity quantification of Pseudomonas spp. isolated from different foods. Food Microbiol. 2016;54:142-153. DOI: 1016/j.fm.2015.10.004
- Marchand S, Vandriesche G, Coorevits A, Coudijzer K, De Jonghe V, Dewettinck K, De Vos P, Devreese B, Heyndrickx M, De Block J. Heterogeneity of heat-resistant proteases from milk Pseudomonas species. Int J Food Microbiol. 2009;133:68-77. DOI: 1016/j.ijfoodmicro.2009.04.027
- Glück C, Rentschler E, Krewinkel M, Merz M, von Neubeck M, Wenning M, Scherer S, Stoeckel M, Hinrichs J, Stressler T, Fischer L. Thermostability of peptidases secreted by microorganisms associated with raw milk. Int Dairy J. 2016;56:186-197. DOI: 1016/j.idairyj.2016.01.025
- Stuknytė M, Decimo M, Colzani M, Silvetti T, Brasca M, Cattaneo S, Aldini G, De Noni I. Extracellular thermostable proteolytic activity of the milk spoilage bacterium Pseudomonas fluorescens PS19 on bovine caseins. J Dairy Sci. 2016;99:4188-4195. DOI. 3168/jds.2016-10894
- Deeth HC. Lipases from milk and other sources. In: Kelly AL, Larsen LB, editors. Agents of Change. Food Engineering Series. Switzerland: Springer; 2021. DOI: 1007/978-3-030-55482-8_10
- Decimo M, Brasca M, Ordóñez JA, Cabeza MC. Fatty acids released from cream by psychrotrophs isolated from bovine raw milk. Int J Dairy Technol. 2017;70:339-344. DOI: 1111/1471-0307.12347
- Rajmohan S, Dodd CE, Waites WM. Enzymes from isolates of Pseudomonas fluorescens involved in food spoilage. J Appl Microbiol. 2002;93(2):205-213. DOI: 1046/j.1365-2672.2002.0167
- Capodifoglio E, Vidal AC, Lima JS, Bortoletto F, D'Abreu LF, Gonçalves AS, Vaz AN, Balieiro JC, Netto AS. Lipolytic and proteolytic activity of Pseudomonas spp. isolated during milking and storage of refrigerated raw milk. J Dairy Sci. 2016;99(7):5214-5223. DOI: 3168/jds.2015-10453
- Woods RG, Burger M, Beven CA, Beacham IR. The aprX-lipA operon of Pseudomonas fluorescens B52: A molecular analysis of metalloprotease and lipase production. Microbiol. 2001;147(2):345-354. DOI: 1099/00221287-147-2-345
- Morandi S, Pica V, Masotti F, Cattaneo S, Brasca M, De Noni I, Silvetti T. Proteolytic traits of psychrotrophic bacteria potentially causative of sterilized milk instability: Genotypic, phenotypic and peptidomic insight. Foods. 2021;10(5):934. DOI: 3390/foods10050934
- Alkhafaje WK, Olama ZA, Ali SM. Molecular characterization and microbial resistance of different bacterial isolates in some dairy products. Iraqi J Vet Sci. 2022;36(2):333-339. DOI: 33899/ijvs.2021.130206.1764
- Al-Rudhan AM, Khalil NK, Altaai NA. Evaluation of bacterial contaminants and heavy metals in cow and buffalo raw milk sold in Baghdad governorate. Iraqi J Vet Sci. 2021;35:101-105. DOI: 33899/ijvs.2021.131744.1999
- Noomi B. Detection of virulence factors of Pseudomonas aeruginosain different animals by using bacteriological and molecular methods. Iraqi J Vet Sci. 2019;32(2):205-210. DOI: 33899/ijvs.2019.153851
- Scarpellini M, Franzetti L, Galli A. Development of PCR assay to identify Pseudomonas fluorescens and its biotype. FEMS Microbiol Lett. 2004;236(2):257-260. DOI: 1016/j.femsle.2004.05.043
- Roberts D, Greenwood M. Practical food microbiology. 3rd UK: Blackwell Publishing Ltd; 2008. 273-274 pp.
- Martins ML, Pinto UM, Riedel K, Vanetti MC. Milk-deteriorating exoenzymes from Pseudomonas fluorescens 041 isolated from refrigerated raw milk. Braz J Microbiol. 2015;46(1):207-217. DOI: 1590/S1517-838246120130859
- Vidal AC, Netto AS, Vaz AN, Capodifoglio E, Gonçalves AS, Rossi GM, Ruiz VA. Pseudomonas spp.: Contamination sources in bulk tanks of dairy farms. Pesquisa Vet Bras. 2017;37(9):941-948. DOI: 1590/s0100-736x2017000900008
- Bellassi P, Rocchetti G, Morelli L, Senizza B, Lucini L, Cappa F. A milk foodomics investigation into the effect of Pseudomonas fluorescensgrowth under cold chain conditions. Foods. 2021;10(6):1173. DOI: 3390/foods10061173
- Anbu P. Characterization of an extracellular lipase by Pseudomonas koreensisBK-l07 isolated from soil. Prep Biochem Biotechnol. 2014;44:266-280. DOI: 1080/10826068.2013.812564
- Baglinière F, Matéos A, Tanguy G, Jardin J, Briard-Bion V, Rousseau F, Robert B, Beaucher E, Gaillard JL, Amiel C, Humbert G, Dary A, Gaucheron F. Proteolysis of ultra-high temperature-treated casein micelles by AprX enzyme from Pseudomonas fluorescens F induces their destabilization. Int Dairy J. 2013;31(2):55-61. DOI: 1016/j.idairyj.2013.02.011
- Meshaan R, Alhaji T. Effect of ohmic heating treatment on different properties of whole cow milk. Mesopotamia J Agric. 2022;50(2):68-76. DOI: 33899/magrj.2022.133744.1171
- Machado SG, Bazzolli DS, Vanetti MD. Development of a PCR method for detecting proteolytic psychrotrophic bacteria in raw milk. Int Dairy J. 2013;29(1):8-14. DOI: 1016/j.idairyj.2012.09.007
- Martins ML, de Araújo EF, Mantovani HC, Moraes CA, Vanetti MC. Detection of the apr gene in proteolytic psychrotrophic bacteria isolated from refrigerated raw milk. Int J Food Microbiol. 2005;102(2):203-211. DOI: 1016/j.ijfoodmicro.2004.12.016
- Decherni S, Benjelloun H, Lebeault JM. Effect of modified atmospheres on the growth and extracellular enzyme activities of psychrotrophs in raw milk. Eng Life Sci. 2005;5(4):350-356. DOI: 1002/elsc.200520082
- Rosenau F, Jaeger K. Bacterial lipases from Pseudomonas: Regulation of gene expression and mechanisms of secretion. Biochim. 2000;82(11):1023-32. DOI: 1016/s0300-9084(00)01182-2
- De Longhi R, Bruzaroski SR, Eleodoro JI, Poli-Frederico RC, Fagnani R, Ludovico A, de Santana EH. Presence of aprX gene in Pseudomonas spp. from refrigerated raw milk and their proteolytic ability. Semin Cienc Agrar. 2020;41(4):1421-1426. DOI: 5433/1679-0359.2020v41n4p1421
- Decimo M, Morandi S, Silvetti T, Brasca M. Characterization of Gram negative psychrotrophic bacteria isolated from Italian bulk tank milk. J Food Sci. 2014;79:2081-90. DOI: 1111/1750-3841.12645
- De Oliveira GB, Favarin L, Luchese RH, McIntosh D. Psychrotrophic bacteria in milk: How much do we really know?. Braz J Microbiol. 2015;46(2):313-321. DOI: 1590/S1517-838246220130963
- Ribeiro Júnior JC, de Oliveira AM, Silva FG, Tamanini R, de Oliveira AM, Beloti V. The main spoilage-related psychrotrophic bacteria in refrigerated raw milk. J Dairy Sci. 2018;101(1):75-83. DOI: 3168/jds.2017-13069
- Zhang C, Bijl E, Svensson B, Hettinga K. The extracellular protease aprX from Pseudomonas and its spoilage potential for UHT Milk: A review. Compr Rev Food Sci. 2019;18:834-852. DOI: 1111/1541-4337.12452
- Ertan H, Cassel C, Verma A, Poljak A, Charlton T, Aldrich-Wright J, Omar S, Siddiqui K, Cavicchioli R. A new broad specificity alkaline metalloprotease from a Pseudomonas sp. isolated from refrigerated milk: Role of calcium in improving enzyme productivity. J Mol Catal B Enzym. 2015;113:1-8. DOI: 1016/j.molcatb.2014.12.010
- Liu M, Wang H, Griffiths MW. Regulation of alkaline metalloprotease promoter by N-acyl homoserine lactone quorum sensing in Pseudomonas fluorescens. J Appl Microbiol. 2007;103:2174-2184. DOI: 1111/j.1365-2672.2007.03488
- Baur C, Krewinkel M, Kranz B, von Neubeck M, Wenning M, Scherer S, Stoeckel M, Hinrichs J, Stressler T, Fischer L. Quantification of the proteolytic and lipolytic activity of microorganisms isolated from raw milk. Int Dairy J. 2015;49:23-29. DOI: 1016/j.idairyj.2015.04.005
- Boran R, Ugur A. Partial Purification and characterization of the organic solvent-tolerant lipase produced by Pseudomonas fluorescens RB02-3 isolated from milk. Prep Biochem Biotech. 2010;40:229-241. DOI: 1080/10826068.2010.488929
- Paludetti LF, Kelly AL, Gleeson D. Effect of thermoresistant protease of Pseudomonas fluorescens on rennet coagulation properties and proteolysis of milk. J Dairy Sci. 2020;103:4043-4055. DOI: 3168/jds.2019-17771
- Dufour D, Nicodème M, Perrin C, Driou A, Brusseaux E, Humbert G, Gaillard JL, Dary A. Molecular typing of industrial strains of Pseudomonas spp. isolated from milk and genetic and biochemical characterization of an extracellular protease produced by one of them. Int J Food Microbiol. 2008;125:188-196. DOI: 1016/j.ijfoodmicro.2008.04.004
- Abdallah KS, Hasan GM. Evaluation the microbial method used to judge the quality control of pasteurized milk. Mesopotamia J Agric. 2018;46(4):327-332. DOI: 33899/magrj.2018.161555
- Nicodème M, Grill JP, Humbert G, Gaillard JL. Extracellular protease activity of different Pseudomonas strains: Dependence of proteolytic activity on culture conditions. J Appl Microbiol. 2005;99(3):641-648. DOI: 1111/j.1365-2672.2005.02634
|