Introduction
Dog blood protozoa can result in various clinical symptoms (1,2), including anemia and thrombocytopenia, even in cases where there is only a small number of parasites in the peripheral blood during acute infection (3,4). The issue is that the anemia's pathophysiology and the parasite's life cycle are poorly understood (5). When many parasites are present in blood smears, examining them is not too difficult (6). However, detecting parasites is far more difficult when their population is small. Thus, sensitive and repeatable techniques for parasite detection are required for basic and clinical veterinary research (4). Direct microscopy of blood smears stained with Giemsa stain is the method most frequently employed to discover parasites in the host (7). Furthermore, blood protozoa are stained with particular fluorescent dyes for deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), such as Hoechst 33342 and acridine orange (8). Nevertheless, these staining dyes are not parasite-specific; they also stain the host's cells. In the past, malaria was diagnosed using RNA and DNA probes specific to the disease (9). Although the sensitivity of the DNA probes is not as high as that of direct microscopy of blood smears, these probes enable the detection of small quantities of parasites (10). Individual parasite numbers and developmental stages are lost since these techniques necessitate partial DNA or RNA purification (11). On the other hand, the precise staining of the parasites by these probes in blood smears or preserved tissues will significantly (11) aid in their microscopical detection (12).
Because there is a little study about B. gibsoni in dogs so this study aims to molecular and phylotegic study of this parasite
Materials and methods
Ethical approval
This study obtained approval from the scientific board, College of Veterinary Medicine, Mosul University, Mosul, Iraq, the approval issue UM.VET.2023.076.
Sample collection
A blood sample was collected from the cephalic vein of 50 dogs (of different ages, sexes, sources, species, and health status). The blood was transferred to anticoagulant EDTA tubes (3).
DNA extraction
Extraction of DNA from blood samples and ticks using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH, Catalog number 51304)
PCR amplification
12.5 μl of PCR Master Mix, 1.0 μl of each forward and reverse primer, 5 μl of template DNA, 2.0 μl of Dimethyl sulfoxide (Genie®), and 5.5 μl of autoclaved triple-distilled water, instructions attempted PCR., described the PCR amplification procedure, which included an initial denaturation of 95 oC for 5 min, followed by 35 cycles of denaturation (30 sec), annealing (30 sec), and extension (90 sec) at 95 oC, 58 oC, and 72 oC, in that order. The final extension was run at 72 oC for 5 minutes-Eppendorf® thermocycling. There was a Master Cycler Gradient. For PCR amplification, species-specific primers for the 18S rRNA gene, Gib599 forward and Gib1270 reverse (13), were employed, with an anticipated product size of 671 bp. Then, ten positive samples were chosen after numerous positive results were obtained. Each sample was then given a genetic sequencing procedure. In Marcrogen Laboratory, Korea, the Basic Local Alignment Search tool is used to find the degree of similarity between the genetic sequences in the database. It may be accessed on the National Center for Life Technologies NCBI website. After that, the MEGA 7 program generates a phylogenetic tree, and the Cluster Omega tool creates the multi-string alignment (Table 1).
Table 1: Showing forward and reverse primers used for the molecular diagnosis of B. gibsoni infection in dogs
|
Gene
|
Primer
|
Primer sequence 5’ → 3
|
Expected product size
|
|
18S rRNA
|
Gib599 Forward
|
TCCGTTCCCACAACACCAGC
|
671 bp
|
|
Gib1270 Reverse
|
TCCTCCTCATCATCCTCATTCG
|
Results
To diagnose B. gibsoni, a polymerase chain reaction test was used, which showed the presence of 19 dogs infected with the parasite through the appearance of positive bands (671 bp) after the electrophoresis of the final products (Figure 1).
Figure 1: Gel electrophoresis image showing: Lane (M) DNA ladder; Lanes (3,5,7-8,12,15) negative samples to B. gibsoni DNA; Lanes (1-2,4,6,9-11,13-14) positive samples to B. gibsoni DNA in approximately band size 671 bp.
The PCR, which can be used to detect the DNA of B. gibsoni, showed a high prevalence of infection in animals that suffer from general weakness and enlargement of lymph nodes; the oldest animal showed a high prevalence of infection with B. gibsoni when compared with the youngest once with significant of variance, male dogs showed high prevalence than female with significant of variance, the native dogs recorded high prevalence than imported. Once with significant variance, the largest breeds showed a higher prevalence than small breeds with significant variance (Table 2).
Table 2: Relationship of infection with B. gibsoni in dogs using molecular methods
|
Factors
|
Criteria
|
Number of animals positive for B. gibsoni using PCR (%)
|
|
Clinical signs
|
General weakness
|
3(15.7)
|
|
Lethargy
|
2(10.5)
|
|
Neurological symptoms,
|
0
|
|
Loss of appetite
|
2(10.5)
|
|
Paleness of the mucous membranes
|
3(15.7)
|
|
Enlarged lymph nodes
|
3(15.7)
|
|
Diarrhea
|
2(10.5)
|
|
Hemoglobin urea
|
1(5.2)
|
|
Presence of ticks
|
2(10.5)
|
|
No clinical signs
|
2(10.5)
|
|
Age of dog
|
Less than 6 months
|
1(5.2) a
|
|
6 months – 1 year
|
5(26.3) b
|
|
1 year-2 years
|
13(68.4) b
|
|
Sex of dog
|
Male
|
13(68.4) a
|
|
Female
|
6(31.5) b
|
|
Source of dog
|
Native
|
14(73.6) a
|
|
Imported
|
5(26.3) b
|
|
Breed of dog
|
Terrier
|
1(5.2) a
|
|
German shepherd
|
7(36.8) b
|
|
Belgium Malenosis
|
4(21)c
|
|
Sebrian huskey
|
3(15.7) c
|
|
Pomeranian dog
|
0
|
|
Pit bull
|
3(15.7) a
|
|
Rottweiler
|
1(5.2) a
|
|
Pekingese
|
0
|
Values significantly different at P<0.05 the different letters.
Genetic sequencing of the B. gibsoni small subunit ribosomal RNA gene revealed the existence of a genetic sequence of the samples given; nevertheless, only one isolate was discovered among all the blood samples received for genetic sequencing. They were registered in the gene bank with a serial number (OR944894.1) and another isolate from ticks (OR944895.1). The results of the multiple sequence alignment of the ssRNA gene of B. gibsoni s showed the presence of fixed regions of the sequence of the nucleotide bases of the ssRNA gene and the presence of common, variable, and missing regions among the sequences. In contrast, the results showed a similarity between the local isolates that carry the registry number of the Bank Genes (OR944894.1 and OR944895.1) and many global isolates registered in the gene bank. The highest similarity rate was 99.50%, and the lowest was 98.74%. The results of the study showed that the phylogenetic tree that was established, that the ssRNA gene of the two genotypes isolated during the study has a phylogenetic tree, while evolutionary with the recorded genetic species, as the proportion of the evolutionary relationship ranged from 98.74-99.50% (Table 3 and Figure 2).
Table 3: There is a similarity between the local sequences ofB. gibsoni and the same pathogen sequences in the GenBank using NCBI BLASTn
|
Accession No. of local sequences
|
Identified Pathogen
|
Query Cover %
|
Similarity Number %
|
Accession Number in the GenBank
|
Identification Country
|
|
OR944894.1
OR944895.1
|
B. gibsoni
|
100
|
99.50
|
MN385427.1
|
Iraq
|
|
99
|
98.74
|
MN689648.1
|
China
|
|
99
|
98.74
|
MN689646.1
|
China
|
|
99
|
98.74
|
MN689645.1
|
Singapore
|
|
99
|
98.74
|
KP666157.1
|
China
|
|
99
|
98.74
|
OP445697
|
China
|
|
99
|
98.74
|
KC461261.1
|
India
|
Figure 2: Phylogenic tree of B. gibsoni in Mosul city, Iraq (*). The phylogenic tree was built using bootstrap analysis with 1000 resamplings and the Maximum Likelihood technique based on the Tamura-Nei model in MEGA11 software. Concatenated partial uvrC gene partial DNA sequences were utilized as input data. The Babesia canis strain (AY649326.1) Russia was used as an outgroup.
Discussion
The present study used a molecular technique to detect Babesia spp. infection in dogs, so this result corroborates with the results of Inokuma et al. (14). However, Das et al. (15) has reported a higher percentage of occurrence. The prevalence of tick populations, the time of year, the host's immune condition, and other management techniques may all impact these fluctuations in canine babesiosis. The results of the clinical examination of the animals included in the study showed the presence of some animals suffering from general weakness, lethargy, neurological symptoms, loss of appetite, paleness of the mucous membranes, enlarged lymph nodes, diarrhea, hemoglobin urea, presence of ticks, while some of them were healthy, the severity of this clinical signs is more obvious in animals which infected with Babesia spp Since a larger number of the parasite in circulating in the blood can be noticed during the initial weeks after infection, light microscopy is advised in situations where there are clinical or epidemiological concerns of an acute phase of Babesia spp. infection (16-18). The clinical results in this investigation were consistent with those previously reported by Schäfer et al. (19).
Dogs that were infected in this investigation ranged in age from one to two years, which is more prevalent than the other age groups. The younger animals recorded a lower prevalence of infection with blood parasites; the prevalence of hemoprotozoan infections has been noted by several authors to be highest in older dogs and younger dogs. Breed predisposition is present in larger breeds, which recorded a high infection prevalence compared to small breeds. However, the low prevalence of the disease decreased according to statistical analysis. No significant association was noted between age alteration in our study. Other studies showed that Blood parasites were more common in German shepherds than mongrels. This can result from the owner's desire for German shepherds and insufficient immunogenic response (20,21).
According to the study, male dogs had a higher frequency of blood parasites than female canines in terms of sex. This result was in line with observations made by Liu et al. (22) and Obeta et al. (23), who noted that male dogs had a higher prevalence of infection than female dogs. However, the results of our study differed from those of Amritpal et al. (13), who discovered that the predominance of male dogs is much higher than that of female dogs. This may be explained by the stronger preference for male dogs over female dogs (24). Based on the data collected for this study, it can be inferred that there is no statistically significant variation in the prevalence of the disease between male and female canines based on the sex of the host. These findings don't align with Irwin et al. (25). More samples were found by PCR in the current investigation, suggesting greater sensitivity and specificity of the test, which is consistent with the results Ionita et al. (26) and Porchet et al. (27). The current study indicated that the age group of >1-2 years had a greater incidence of canine babesiosis 23%, which is consistent with data from Bulusu et al. (16) and Laha et al. (28). This conclusion may be because young dogs' immune systems are less developed than those of adults. Numerous authors have documented cases of babesiosis in dogs of various ages. Thus, it may be concluded that the host's immune system and the transmitting vector determine whether a person contracts Babesia, rather than age being the determining factor. According to the results of Guo et al. (29), most affected canines in this study were male 57.5% instead of female. Nevertheless, some Bulusu et al. (16), Amuta et al. (30) and Selvaraj et al. (31) have suggested no substantial correlation between the host's breed and the incidence of babesiosis. The results of the relationship between the infection of B. gibsoni and the clinical manifestation in dogs showed high prevalence in animals that suffer from general weakness and enlargement in lymph nodes, while the animals which appear neurological symptoms not record any infection with B. gibsoni, Hassanen et al. (32) recorded of the 75 dogs that were tested, 26.67% (20/75) had clinical symptoms consistent with a canine babesiosis infection, including fever, anorexia, dullness, weakness, crimson urine, and pale mucous membranes. The relationship of age of dogs with infection B. gibsoni showed a high prevalence in old dogs compared with young ones; several studies showed high the findings were consistent with those of Selvaraj et al. (31), showing that the condition was more common in older canines than in younger ones. Similar studies with a high illness incidence in elderly animals are shown in the current study.
The current investigation discovered that several dog breeds were positive, including Great Dane, Doberman, Spitz, Terrier, Irish setter, Pug, and non-descript dogs. Amritpal et al. (13) observed that, among 68 dogs suspected of having babesiosis, there was a statistically nonsignificant difference in the incidence of B. gibsoni among different breeds and nondescript dogs. Breeding management is another reason for the difference in the prevalence of infection with B. gibsoni according to breed. Large breeds of dogs are already present in gardens outside of homes, which results in contact with different arthropods that transmit the Babesia infection, while small breeds are already present in the home, which decreases direct contact with arthropods. In relation to the host's breed, the findings showed that PCR and blood smear analysis found a statistically nonsignificant variation in the prevalence of B. gibsoni across the different breeds and nondescript dogs. Hornok et al. (33) discovered 21 female and 47 male dogs, seven male, and two female dogs contracting B. gibsoni infections, while Fisher's exact test revealed no statistically significant difference (34). Nine of the 68 canines in the current investigation, which used blood smear and/or PCR, were positive for B. gibsoni infection. Other researchers Deepa et al. (35) showed that every dog that tested positive for blood smears tested positive for PCR. Low parasitemia was thought to be the cause of the two samples' erroneous negative results from blood smear tests. The current investigation confirms that PCR analysis was more effective in diagnosing infection than blood smear inspection. Laha et al. (28) discovered that PCR molecular analysis was more accurate in diagnosing B. gibsoni infection than standard blood smear examination. The presence of a genetic sequence for the samples of dogs sent in from the city of Mosul was revealed by the findings of the genetic sequencing of the Babesia gebsoni 18S rRNA gene. Out of all the samples that were sent for genetic sequencing, it was discovered that there were just two isolates. (OR944894.1 and OR944895.1) This variation in the similarity rate indicates the genetic diversity of the parasite, which is the result of genetic changes and mutations in it (36). The results of conducting the genetic sequence of the 18S rRNA gene of B. gebsoni, comparing it to the genetic sequence of some international strains registered in GenBank, showed that the highest percentage of similarity to the local isolate was 98.47% with the strain under the genetic name MN689648.1, which was isolated from China, Singapore, and India. This relationship is conclusive evidence of a high genetic correlation between these species (37). At the same time, the isolated strains in the study in terms of their location in the phylogenetic tree (38). This divergence and convergence between local and global strains indicates the common evolutionary origin of the strains from a genetic standpoint (39).
Conclusions
Dogs affected B. gibsoni, and there are more dominant parasites in dogs in Nineveh province.
Acknowledgment
The authors would like to thank the College of Veterinary Medicine at the University of Mosul for providing financial support for this work and the veterinary teaching hospital for their valuable assistance.
Conflict of interest
The authors declare that there is no conflict of interest in the manuscript.