Introduction
Cytauxzoonosis is an emerging tick-borne disease (1). These parasites, caused by Cytauxzoon felis (Theileria felis), are classified as Phylum Apicomplexa, Class Aconoidasida, and Family Theileriidae (2). Amblyomma americanum and Dermacentor variabilis ticks transmit the disease to both domestic and wild cats (3). Cytauxzoonosis, is a quickly progressive systemic disease with a high mortality rate, as well as mechanical restriction of blood flow across numerous organs, resulting in a shock-like state and intravascular and extravascular hemolysis due to merozoite invasion of erythrocytes (2). Moreover, there are other symptoms such as inappetence, lethargy, anorexia, weight loss, depression, dehydration, diarrhea, vomiting (4), dyspnea, tachycardia, hemolytic crisis, jaundice, recumbency, and death (5,6). Ketosis can be diagnosed clinically by observing C. felis in infected tissues or microscopic examination of thin blood smears stained with Wright-Giemsa for C. felis piroplasms. These approaches are frequently utilized but are less sensitive to detecting C. felis infection (7). The Polymerase Chain Reaction is an accurate technique (8-11). Creating and implementing a sensitive and specific PCR technique to detect C. felis in feline blood samples will aid in diagnosing feline cytopathic illness. Furthermore, this assay can study the spread of C. felis in domestic and wild cats (12). Several real-time or nested PCR experiments have targeted the C. felis 18S ribosomal RNA gene or its internal transcribed spacer 2 (ITS2) region (13). A recently designed real-time PCR test that targets the C. felis mitochondrial cox3 gene has demonstrated improved diagnostic sensitivity (14). However, this test uses double-stranded DNA molecules (SYBR Green I or EvaGreen), which may lead to the detection of specific and non-specific amplification products during the PCR reaction, increasing the likelihood of false positives (15). Cytauxzoon manul has been detected in naturally infected Pallas' cats (Otocolobus manul) from Mongolia; an unidentified kind of Cytauxzoon has been discovered in Spanish household cats throughout Europe (16). Wild cats in Spain, Romania, Italy, and Bosnia and Herzegovina (Hodžic) have also been shown to carry the infection (17). In addition, it includes France, Italy, Portugal, and Switzerland (18). The cat is lovely animals (19-24).
Therefore, the study aimed to identify the types of Cytauxzoonosis infecting cats in Mosul using the microscopic and molecular diagnosing (PCR, sequence, and phylogenetic study) to improve disease control due to a lack of research on the feline Cytauxzoonosis parasite.
Materials methods
Ethical approval
This analysis was accepted by the Academic Committee of the Microbiology Department of the College of Veterinary Medicine, University of Mosul, in October 2023.
Animals and Blood sample collection
Blood samples were gathered from 50 stray cats randomly collected from Mosul city. The blood collection location was thoroughly sanitized with 70% ethyl alcohol to disinfect the area before inserting the needle and drawing blood from peripheral and saphenous veins using sterile syringes. Three ml of blood samples from each cat were stored in tubes containing EDTA. The specimen was then transported to the College of Veterinary Medicine, University of the Mosul, Analysis Laboratory.
Microscopically examination
A slim blood smear was produced, stained by Giemsa stain, and inspected using an optical microscopic examination. Thin blood smears were utilized to assess the morphology, and in measurements, the Ocular micrometer was used for the laboratory diagnosis of Cytauxzoon felis in cats (25). Parasitism ratio was calculated using the following formula:
The number of RBCs affected is divided by the total number of RBCs counted multiplied by 100.
Hematological parameters
A digital blood analyzer subjected the feline blood sample to a complete blood count.
DNA extraction
DNA was isolated from five Cytauxzoon-infected bloodsampling using the DNA extraction kit from (Qiagen). To rehydrate the DNA pellet, add 100 μl of hydrate solution. Store at -20ºC until a Genomic DNA Estimation.
Polymerase chain reaction
Table 1 shows the sequences of primers used in PCR to diagnose Cytauxzoon felis, where specific primers are used to amplify the DNA. The second table illustrates the PCR program used to amplify the DNA of Cytauxzoon felis using the primers (Table 1). This program includes the steps of denaturation, primer annealing, and extension, facilitating accurate and rapid diagnosis. PCR reactive mixing was prepared in a 20 μl vessel containing 10 μl of the master mix, 1 μl of primers, four μl of template DNA, and four μl of PCR-grade water. Following the completion of the PCR with a thermocycler (Optimum 96 G Germany), the multiplication reaction was carried out using the bespoke software mentioned in table 2.
Table 1: Types of the primers and their sequence (26)
|
Primer
|
Sequence
|
|
Forward
|
CCTGGTTGATCCTGCCAG
|
|
Revers
|
CGACTTCTCCTTCCTTTAAG
|
Table 2: Steps of the conventional PCR scheme
|
Stage
|
ºC
|
Time
|
Cycle number
|
|
Initial denaturation
|
95
|
6 min.
|
1
|
|
Denaturation
|
95
|
45 sec.
|
35
|
|
Annealing
|
56
|
1 min.
|
|
Extension
|
72
|
1 min.
|
|
Final extension
|
72
|
5 min.
|
1
|
Sequencing and phylogenetic analysis
PCR amplicons were sent to Macrogen Company (South Korea) for purification and sequencing after they tested positive for Cytauxzoon felis using the PCR technique. The 18S rRNA sequences were subjected to multiple sequence alignment using the GenomeNet online tool. Following this, the NCBI BLAST from NCBI was used to compare the sequences with other sequences available in GenBank. With MEGA11 software, the Likelihood method on the Tamura-Nei model and bootstrap analysis with 1000 resampling (16). In addition, the constructed phylogenetic tree used the 18S rRNA gene sequence of MF536661.1 Theileria bicornis as an outgroup.
Statistical analysis
Chi-square tests and SPSS version 19 odds ratios were used to calculate differences in C. felis prevalence. Differences at P≥0.05 were considered statistically significant.
Results
Microscopic examination of infected blood revealed no substantial difference in the form or size of red blood cells, indicating a strong intracellular parasitization of merozoites. It is a limited peripheral region of red blood cells with a blue nucleus shaped like a stage or nucleus and a small amount of cytoplasm. The parasite has an average length of 1.2±3 micrometers and a width of 1.2±1 micrometer. The parasite was evaluated using its morphological phases in red blood cells (Figure 1). Table 3 shows the infection rate of Cytauxzoon felis among cats in Mosul city. Out of 50 cats examined, 38 (76%) were infected, while 12 (24%) were not infected (Table 3). Table 4 illustrates the intensity of Cytauxzoon felis infection among infected cats in Mosul city. Out of 38 infected cats, 21 (55.3%) had a chronic infection, 10 (26.3%) had a subclinical infection, and 7 (18.4%) had an acute infection (Table 4).
Figure 1: Cytauxzoon felis was discovered in thin blood smears stained with Giemsa and photographed at 100X.
Table 3: The infection rate with Cytauxzoon felis in cat
|
Type of infection
|
Number (total)
|
Infection (%)
|
|
Infected
|
38 (50)
|
76%
|
Table 4: The intensity of infection and percentage of Cytauxzoon felis in cats in Mosul city
|
Intensity of infection
|
Chronic
|
Subclinical
|
Acute
|
|
Total infected (38)
|
21
|
10
|
7
|
|
Percentage %
|
55.3
|
26.3
|
18.4
|
Table 5 shows the differences in Complete blood count values between healthy cats and cats infected with Cytauxzoonosis. The letters 'a' and 'b' indicate significant differences between the two groups, and the different values reflect the impact of the disease on various blood parameters. In this study, cats infected with Cytauxzoon felis showed significant differences in hematological parameters, including cell volume, platelet count, hemoglobin Hb, and total erythrocyte count (TEC), compared to the healthy group. The study found a significant rise in MCV and a significant drop in MCH and MCHC, indicating macrocytic hypochromic anemia in cats infected with C. felis. Furthermore, cats infected with Cytauxzoon felis had significantly lower total and differential leukocyte counts., resulting in a considerable drop in the percentages of lymphocytes and neutrophils but no significant difference in monocytes, eosinophils, or basophils. Compared to the healthy group (Table 5).
Table 5: Complete blood count associated with Cytauxzoonosis
|
Parameters
|
Range (mean±SE)
|
|
Healthy group
|
Infected Cats with Cytauxzoonosis
|
|
TRBC (1012/ML)
|
4.5-9.44 (6.9±0.41a)
|
3.1-8.00 (5.55±0.27b)
|
|
HB (g/L)
|
88.00-145.00 (116.5±4.41a)
|
59.00-110.00 (84.5±3.77b)
|
|
PCV (%)
|
20.1-44.2 32. (15±1.72a)
|
17.00-34.50 (25.75±1.11b)
|
|
MCV (FL)
|
44.6– 46.82 (45.71±1.28a)
|
43.12-54.8 (48.8±1.57b)
|
|
MCH (pg)
|
15.4-19.5 (17.4±0.89a)
|
13.75-19.0 (16.3±0.35b)
|
|
MCHC (g/L)
|
328.00-437.80 (382.9±21.08a)
|
318.8-347,0 (332.0±10.34b)
|
|
PLT (109/L)
|
310.00-960.00 (635.00±40.05a)
|
202.00-758.00 (480.87±31.64b)
|
|
TWBC (109/ML)
|
11.20-24.40 (17.8±1.30a)
|
6.40-16.30 (11.35±0.48b)
|
|
LYM (%)
|
16.30-45.20 (30.75±2.31a)
|
12.30-36.40 (24.35±1.23b)
|
|
NEUT (%)
|
38.20-78.10 (58.15±2.54a)
|
28.50-70.20 (49.35±1.93b)
|
|
MON (%)
|
0.20-4.60 (2.4±0.32a)
|
0.00-4.90 (2.45±0.31a)
|
|
EOSI (%)
|
1.11-11.90 (6.5±0.89a)
|
0.00-10.50 (5.25±0.51a)
|
|
BASO (%)
|
0.00-1.70 (0.85±0.16a)
|
0.00-1.60 (0.8±0.11a)
|
Different letters in each variable mean statistically significant difference at P<0.05.
Figure 2: DNA bands extracted from Cytauxzoon spp.
The bands present at 1600 bp indicate that the samples contain DNA from the Cytauxzoon genus, which was confirmed by amplifying the targeted 18s rRNA region. The absence of bands in some wells (empty wells) means that those samples do not contain Cytauxzoon DNA or that the amplification process was unsuccessful for those samples. The results indicate that some of the tested samples contain DNA from the Cytauxzoon genus, based on the presence of bands at the expected 1600 bp size. This demonstrates the effectiveness of using PCR to diagnose the presence of Cytauxzoon in the tested samples (Figure 3).
Figure 3: PCR reaction of Cytauxzoon genus based on the 18s rRNA region and amplification product of 1600 bp.
This table presents the nucleotide sequence of the ITS1 and ITS2 regions for the local Cytauxzoon felis isolate Sesa (GenBank accession number LC775709.1). The table presents the sequence details of Cytauxzoon felis a genotype discovered in an area. It displays the sequences for ITS1 and ITS2 which are utilized in research and molecular testing. The sequence consists of nucleotides essential for genetic identification and analysis. This information has been formally submitted to GenBank. Table 6 shows that the local genome sequence of Cytauxzoon felis Sesa (LC775709.1) is highly similar to sequences found in geographically diverse regions such as Switzerland, Italy, France, and the USA. However, there are notable genetic differences compared to sequences from Brazil and South Africa.
Table 6: Homology using BLAST n between the local sequence (LC775709.1) of C. felis and other genotypes
|
Name of strains
|
GenBank-NCBI No.
|
Query cover
|
Sequence Identity
|
Country
|
|
Cytauxzoon felis isolate 303
|
KU306946.1
|
100%
|
100%
|
Switzerland
|
|
Cytauxzoon spp. voucher 40429
|
OM004053.1
|
100%
|
100%
|
Italy
|
|
Cytauxzoon spp. cat/France 1/2008
|
EU622908.1
|
100%
|
99.9%
|
France
|
|
Cytauxzoon spp. Aliso
|
EF094468.1
|
100%
|
99.7%
|
USA
|
|
Cytauxzoon europaeus isolate WC_L68
|
MT904044.1
|
87%
|
99.92%
|
Czech Republic
|
|
Cytauxzoon spp.
|
GU903911.1
|
100%
|
96.2%
|
Brazil
|
|
Cytauxzoon felis
|
L19080.1
|
100%
|
96%
|
South Africa
|
Interpretation of the phylogenetic tree
The figure shows a phylogenetic tree illustrating the genetic relationships between the local sequence (LC775709.1) of the Sesa gene of Cytauxzoon felis from Mosul/Iraq and other sequences of the same parasite from different countries (Figure 4).
Figure 4: the partial sequence of the 18D rRNA.
Discussion
A stained peripheral blood film revealed that 76 percent of the cats were infected with Cytauxzoon felis, as evidenced by piroplasma between red blood cells. The low identification of intracellular piroplasma during early acute-phase microscopic examination contributes to high infection rates (16). The abundance of Amblyomma americanum and Dermacenter variabilis is also important for the sample approach (27). Also, due to tick vectors' high adaptability to different species, their geographical range is projected to expand ecology and host species (28-30). An 80% prevalence of bobcats in Oklahoma (31), the positive rate 78% was comparable to that observed in domestic cats from the United States and can be quite high 79% (32).
Giemsa stain approach resulted in a reduced infection rate 41.5% and 33% (33-35). Other clinical trials have found modest levels of parasitemia (25-37). The current study found that cats infected with C. felis have hypochromic macrocytic anemia and a significant drop in PCV, platelet count, hemoglobin, and total red blood cell count, indicating anemia. This result was consistent with research conducted in Iran (38), which also demonstrated that PCV was 31.8% in lynx with spontaneous infection of Cytauxzoon felis
Our findings show that a considerable drop in MCH and MCHC in C. felis-infected cats indicates macrocytic hypochromic anemia. Iron deficiency and hemolysis may cause a relative drop in MCH and MCHC levels. MCH and MCHC were lower in the naturally infected group (39,40). The most common clinical signs in cats with hemoplasmosis include anemia (41-43).
In addition, cats infected with C. felis have a considerable drop in total and differential white blood cell counts. Low white blood cell counts may indicate a bad prognosis (44). Anemia, leukopenia with left shift, toxic neutrophil alterations, and thrombocytopenia are frequently identified in the late stages of the disease (45). Neutropenia and lymphocytosis were described in a mountain lion (Puma concolor) with Cytauxzoon-like piroplasma in its blood sample (46), a moderate reduction in red blood cells (anemia), an increase in lymphocyte counts 68% and a decrease in the number of neutrophils 14%, increased vacuolation and toxic changes in neutrophils, resulting in an increase in monocytes 12%, eosinophils 2%, and basophils 0% were in the normal range (47). Microscopic examination of Giemsa-stained blood smears must be more comprehensive to discover and identify difficult-to-classify parasite species (48).
Conclusion
The study's conclusion showed that the rate of Cytauxzoon spp parasite infection in cats in Mosul, Iraq, reached 76%. Genetic sequencing results revealed the identification of a new isolate, Cytauxzoon felis Sesa (LC775709.1) 18S rRNA gene, partial sequence. The phylogenetic tree revealed that the local sequence (LC775709.1) of the Cytauxzoon felis Sesa ITS1, ITS2 genotype is very closely related genetically to the sequences from Europe and the USA while showing some genetic differences with the sequences from Brazil and South Africa. This may reflect genetic branching and local adaptation of the parasite in different geographical regions.
Acknowledgments
Thanks to the College of Veterinary Medicine for their contributions and encouragement for this work.
Conflict of interest
None.