Introduction
Sheep are a significant source of both meat and milk for human use. The yearly need for animal-based protein is increasing. Therefore, maintaining excellent reproduction in herds is essential for overcoming the deficit since animal reproductive performance is correlated with the population's nutritional demands for meat, milk, and wool for industry (1). Worldwide, farmers suffer large financial losses as a result of domestic ruminant abortions (2). It is known as the fetus being forced out from the uterus before it is viable and fully developed (3). Ovine abortion can be caused by non-infectious factors such as nutritional deficiencies, genetic disorders, metabolic disorders, physical trauma, damage, and toxins, as well as infectious agents. Zoonotic pathogens like Toxoplasma gondii, Campylobacter spp., Chlamydia abortus, Coxiella burnetii, and Brucella melitensis are considered to be among the most common infectious causes of abortion in sheep, even though their frequency and occurrence vary depending on the geographic region (4-6). Within the genus Escherichia and family Enterobacteriaceae, E. coli is a rod-shaped, facultative anaerobic, gram-negative coliform bacterium (7). It is also a commensal bacterium species found in the gastrointestinal tract of many different kinds of mammals. However, not all Escherichia coli strains are beneficial; some may infect animals and cause illnesses (8,9). There are two types of pathogenic strains of Escherichia coli: those that induce extraintestinal diseases and those that cause intestinal diseases (10,11). At the Veterinary Laboratories Agency-Weybridge, Escherichia coli was recovered in pure culture from the placentae and fetal stomach contents of a recently aborted fetus during the lambing season. Additionally, the combined clinical and pathological results indicated that maternal bacteremia and placentitis linked to a verotoxigenic strain of Escherichia coli were the cause of the abortion outbreak (12). The findings of Beutin et al. (13) indicate that pregnant ewes infected with verotoxigenic Escherichia coli may lose over 20% of their lambs. Sensible measures should be taken to reduce the danger of human infection since verotoxigenic Escherichia coli, like other causes of ovine abortion, can cause serious illness in humans. Identification of the etiological agent causing an abortion outbreak has important implications for disease control, prevention of future outbreaks, and management of dangers to public health (14).
Therefore, the current study aimed to isolate Escherichia coli as possibly linked to ovine aborted fetuses, confirm the isolates using PCR, identify the virulence genes, and verify the genetic relatedness of local isolates via 23SrRNA gene amplification, sequencing, and phylogenetic analysis.
Materials and methods
Ethical consent
The sample collecting methods were authorized in August 2023 under approval issue number UM.VET.2023.121 in 17/8/2023.
Samples collection
Between September 2023 and March 2024, fifty swabs were obtained from the stomach contents (25 swabs) and placenta (25 swabs) of twenty-five fetuses that ewes aborted during the latter stage of pregnancy. The swabs were placed in sterile tubes containing nutrient broth for the conventional isolation processes.
Bacterial isolation and culture media
The swabs were cultivated on MacConkey, Eosin Methylene Blue, and Brain Heart Infusion agar. The suspected colonies of E. coli were re-cultured based on their morphological characteristics and biochemical tests. The Vitek2 system (BioMerieux, France) was also used for further confirmation (15).
DNA extraction
DNA extraction was performed on all verified isolates to facilitate molecular conformation of the species and detect the virulence genes uidA and zapA. In accordance with the company's instructions, the AddPrep kit (Addbio, South Korea) was used to extract DNA. The DNA samples were kept at -20°C until utilized.
Polymerase chain reaction
All obtained isolates were molecularly confirmed using the 23SrRNA gene-specific primers ECO223-F and ECO 455-R. Additionally, PCR screening was performed on all isolates to verify the presence of two sets of virulence genes (uidA and zapA). All primers were obtained from Macrogen, South Korea, and the amplified products and primer sequences were summarized in table 1.
Table 1: Primers, sequences, and product size utilized in the identification of Escherichia coli and virulence genes (uidA, zapA)
|
Primer name
|
Sequence of the primers (5- to 3- )
|
Size (bp)
|
Reference
|
|
ECO
|
223-F
|
ATCAACCGAGATTCCCCCAGT
|
232
|
(16)
|
|
455-R
|
TCACTATCGGTCAGTCAGGAG
|
|
uidA
|
F
|
AAAACGGCAAGAAAAAG CAG
|
623
|
(17)
|
|
R
|
ACGCGTGGTTACAGTCTT GCG
|
|
zapA
|
F
|
ACCGCAGGAAAACATATAGCCC
|
540
|
(18)
|
|
R
|
GCGACTATCTTCCGCATAATCA
|
With the exception of the annealing temperature, the standard PCR technique was followed for all primers. In summary, 25 µl was used, which included 12.5 µl of Hot Start Taq Premix (2X) from Addbio, South Korea, 1 µl of each forward and reverse primer, 2 µl of extracted DNA, and 8.5 µl of PCR water. A thermocycler (BioRad, USA) was utilized for amplification. The conditions for PCR cycles are listed in table 2. The 1.5% agarose gel (Bio-Rad, USA) with 3 µl of GelRed safe Dye (Addbio, South Korea) was used to electrophorize the outcomes of the PCR. Each PCR product was placed into a corresponding well of a prepared agarose gel using eight microliters. A volume of 4 µl of DNA standard marker, 100 bp (Addbio, South Korea), was used to identify the acquired products. A UV transilluminator and digital camera (Bio-Rad, USA) were used to view the results.
Table 2: The cycling conditions utilized in PCR amplification
|
Phase
|
ºC
|
Time
|
Cycles (n)
|
|
Initial Denaturation
|
95ºC
|
10 min
|
1
|
|
Denaturation
|
95ºC
|
45 sec
|
35
|
|
Annealing
|
*ºC
|
45 sec
|
|
Extension
|
72ºC
|
1 min
|
|
Final extension
|
72ºC
|
5 min
|
1
|
|
Hold
|
4ºC
|
∞
|
|
* Annealing temperature at 55ºC for E. coli 23SrRNA gene, 58ºC for uidA and 59ºC for zapA genes
Sequencing and phylogenetic analysis
Two amplicons were sequenced following PCR amplification of the Escherichia coli 23SrRNA gene (Macrogen, South Korea). The acquired gene sequences were analyzed using BLAST against GenBank-recorded Escherichia coli 23SrRNA gene sequences from different nations. The MUSCLE program was used to perform multiple alignments using MEGA 11 software. The 23SrRNA gene's phylogenetic analysis was conducted using the MEGA 11 program's Maximum Likelihood approach. The Maximum Likelihood tree's group resilience was assessed using one hundred bootstrap resampling (19).
Results
Bacterial culture and biochemical tests
The Escherichia coli was detected in 10% (5/50) of the specimens. There were 12% (3/25) in the contents of the fetal stomach and 8% (2/25) in the placenta. Both media (MacConkey and Eosin Methylene Blue agar) displayed bacterial colonies with a dark pink morphology. Furthermore, Vitek2 confirmed every Escherichia coli isolate following positive outcomes from the specific biochemical tests.
PCR for confirmation of the isolates and identification of virulence genes
Following gel electrophoresis, the PCR results for all five isolates were positive for Escherichia coli, targeting the 23SrRNA gene with a product size of 232 bp (Figure 1). Furthermore, molecular screening for virulence genes in Escherichia coli showed that all isolates possessed the uidA gene 100% (Figure 2). PCR for the presence of the zapA virulence gene revealed that 2/5 (40%) of the isolates had the gene (Figure 3).
Figure 1: Agarose gel electrophoresis of PCR products. Lane M, DNA marker (100 bp); lanes 1-5 positive samples of Escherichia coli giving 232 bp product size; lane 6 negative control.
Figure 2: Agarose gel electrophoresis of PCR products. Lane M, DNA marker (100 bp); lanes 1-5 positive samples of uidA gene giving 623 bp product size; lane 6 negative control.
Figure 3: Agarose gel electrophoresis of PCR products. Lane M, DNA marker (100 bp); lanes 1-3 negative isolates; lanes 4 and 5 positive isolates of zapA gene giving 540 bp product size; lane 6 negative control.
Sequencing and phylogenetic analysis
The local two Escherichia coli strains (AOB-EC1-M24) with accession numbers PQ191249.1 and PQ191250.1, identified by sequence analysis of the 23SrRNA gene, exhibited 100% similarity with the previously published strains from China, USA, United Kingdom, Switzerland, Germany, South Korea, Japan, Turkey, Belgium, Finland, Australia, New Zealand and Spain (Table 3).
Table 3: Sequence identity between local Escherichia coli strain AOB-EC1-M24 (PQ191249.1, PQ191250.1) and other strains have recorded in the GeneBank.
|
No.
|
Escherichia coli strain
|
GenBank accession number
|
Country
|
Sequence identity
|
|
1.
|
Escherichia coli strain W170
|
CP163029.1
|
China
|
100%
|
|
2.
|
Escherichia coli O157:H7 strain K1516
|
CP049612.1
|
USA
|
100%
|
|
3.
|
Escherichia coli strain RHB16-SO-C08
|
CP099209.1
|
UK
|
100%
|
|
4.
|
Escherichia coli strain LH13-b
|
CP100525.1
|
Switzerland
|
100%
|
|
5.
|
Escherichia coli strain CM13
|
CP114893.1
|
Germany
|
100%
|
|
6.
|
Escherichia coli strain Z0117EC0032
|
CP098217.1
|
South Korea
|
100%
|
|
7.
|
Escherichia coli 2018-11-3CC DNA
|
AP021895.1
|
Japan
|
100%
|
|
8.
|
Escherichia coli strain 179
|
CP062924.1
|
Turkey
|
100%
|
|
9.
|
Escherichia coli strain ETEC4077
|
CP122648.1
|
Belgium
|
100%
|
|
10.
|
Escherichia coli strain ATCC 11303
|
CP140008.1
|
Finland
|
100%
|
|
11.
|
Escherichia coli isolate MSB1-9I-sc-2280417
|
LR890508.1
|
Australia
|
100%
|
|
12.
|
Escherichia coli isolate SC475
|
LR778148.1
|
New Zealand
|
100%
|
|
13.
|
Escherichia coli strain LIM
|
CP026027.1
|
Spain
|
100%
|
Additionally, fifteen 23SrRNA gene sequences from various Escherichia coli strains were combined into a Maximum Likelihood phylogenetic tree. The tree's confidence was ensured by using a 100 times bootstrap value. The phylogenetic tree showed the existence of two clades, with 100 similarities among the 23SrRNA gene sequence members, namely clade 1 and clade 2. Clade 1 consists of the strains CP114893.1, CP122648.1, CP140008.1, LR890508.1 and CP026027.1 from Germany, Belgium, Finland, Australia and Spain, respectively. Clade 2 consists of the strains PQ191249.1, PQ191250.1- CP163029.1, CP049612.1, CP099209.1, CP100525.1, CP114893.1, CP098217.1, AP021895.1, CP062924.1 and LR778148.1 from Mosul, China, USA, United Kingdom, Switzerland, South Korea, Japan, Turkey and New Zealand, respectively (Figure 5). Based on the generated phylogenetic tree, it has been determined that the 23SrRNA gene is preserved in all Escherichia coli strains, and local strains were more closely to Escherichia coli strain W170 (CP163029.1) and Escherichia coli O157:H7 strain K1516 (CP049612.1) from China and USA, respectively (Figure 4).
Figure 4: Phylogenic tree of local Escherichia coli strain AOB-EC1-M24 (PQ191249.1, PQ191250.1) and other strains have been recorded in the GeneBank. The 23SrRNA gene is preserved in all Escherichia coli strains, and these sequences' phylogenetic analysis mostly identified two clades with 100 similarities among the 23SrRNA gene sequence members.
Discussion
The most serious problem is herd abortion since it has a significant adverse economic impact on animal fertility, meat production, and milk supply (20). The present investigation detected Escherichia coli in 10% (5/50) of the specimens. This finding is consistent with the study by Esmaeili et al. (21), who found that the prevalence of Escherichia coli was low in aborted flocks, and this bacterium is the main cause of sporadic abortions (22). Also, this study was in line with the study's findings, which showed that 13 isolates, or 7% of the total, came from fetuses that had been aborted and showed signs of tissue degradation (23). According to earlier studies, endotoxins from gram-negative bacteria like E. coli can induce abortions through prostaglandin release (24,25). Conversely, Escherichia coli and other bacteria associated with sporadic abortions are probably opportunists (26). This outcome is also consistent with research by Van Engelen et al. (27), who found that Escherichia coli was the cause of 5% of sheep abortions among 98 ovine fetuses. However, the presence of Escherichia coli in aborted fetuses may be due to a lack of knowledge, unsanitary conditions in most rural regions, and environmental factors (28). The final confirmation of Escherichia coli was determined by the polymerase chain reaction technique, which has a high sensitivity for detecting bacteria based on DNA (29). Furthermore, molecular screening for virulence genes in Escherichia coli showed that all isolates possessed the uidA gene (100%). At the same time, PCR for the presence of the zapA virulence gene revealed that 2/5 (40%) of the isolates had the gene. Escherichia coli is recognized and categorized based on these genes that produce virulence factors. In order to detect and diagnose the genes involved in pathogenicity, the polymerase chain reaction is utilized, which sets it unique from other assays (30,31). These findings are consistent with the conclusions established by researchers regarding the significance of virulence genes, which are essential for diagnosing bacteria because they produce the enzymes that the bacteria use in biochemical reactions.
Moreover, several virulence features that Escherichia coli possess, such as uidA and zapA, enable the bacteria to cause fetal mortality as well as antibiotic resistance (32-34). Two strains have the zapA gene, which produces the enzyme protease. It is considered one of the important enzymes because it can break down IgA and IgG antibodies, reducing the immune response in fetuses and causing abortion. For this reason, the enzyme is a significant virulence factor for the Escherichia coli that produces it (35,36). Table 3 displays the results of the 23SrRNA gene BLAST of the two strains against several strains accessible in Genbank. The 23SrRNA gene alignment data demonstrates the similarity (100%) between the aligned nucleotide sequences. The two strains under study tended to have a nucleotide sequence similar to those of the same species.
Furthermore, the phylogenetic tree showed the existence of two clades, with 100 similarities among the 23SrRNA gene sequence members. It has also been determined that the 23SrRNA gene is preserved in all Escherichia coli strains, and local strains were more similar to Escherichia coli strain W170 (CP163029.1) and Escherichia coli O157:H7 strain K1516 (CP049612.1) from China and USA, respectively. Based on these results, it is thought that the fifteen strains of the tree have similar genetic and metabolic characteristics and have very close relationships (37). The same findings were also demonstrated by earlier research by Abuelhassan et al. (38), and Ayoade et al. (39), who noted in their phylogenetic tree that the Escherichia coli isolates under investigation were very similar to those found in other regions of the world (40).
Conclusion
Escherichia coli should not be ignored as a cause of abortion; rather, it should be appropriately handled because it has been linked to abortion in pregnant ewes. Furthermore, the isolated Escherichia coli possess the virulence genes uidA and zapA, which enable the bacteria to cause fetal death and abortion. According to phylogenetic analysis, the local isolates of Escherichia coli seemed more like American and Chinese strains.
Acknowledgment
The study was funded by the College of Veterinary Medicine at the University of Mosul in Mosul, Iraq.
Conflict of interest
The authors declare that they have no conflicts of interest related to the publication of this work.