Introduction
Theileria equi is an infectious disease spread by ticks that causes equine theileriosis. (1). Four possible forms occur in the equine infected with T. equi: acute, chronic, or, most commonly, inapparent form (2). Clinical signs include fever, anemia, inappetence, edema, icterus, hepatomegaly, splenomegaly, and, in rare cases, mortality (3,4). The disease, which has been added to the OIE list, is global in scope, as treatment costs, abortions, loss of activity, and death are the most common economic losses (4,5). In Egypt, the prevalence of T. equi varies according to the age, sex, months, seasons, and geographic location of the horses (5-8). Diagnosis of T. equi by microscopic examination (ME) of the blood smear ispossible in the acute phases with high enough numbers of parasites in the circulation and observed intraerythrocytic (2); otherwise, diagnosis by Conventional Polymerase Chain Reaction (cPCR) is sensitive and highly specific than any other method and the best accurate diagnosis choice in T. equi infection seroprevalence in all phases (9,10). Numerous equine studies have examined the biochemical alterations linked to T. equi infection (5). Total protein, globulin, bilirubin (total, direct, indirect), and enzyme activities of alkaline phosphatase (ALP), aspartate aminotransferase (AST), and gamma-glutamyl transpeptidase (GGT) were found to be significantly higher with the study by Ozdek et al. (11). Ahmadpour et al. (12) found increased urea and creatinine in horses naturally infected with T. equi compared to the healthy group (12). T. equi was found in an experimental infection in the blood and other tissues like the lungs, livers, spleens, and bone marrow (13,12). A histological investigation revealed microthrombi in the liver and lung as well as centrilobular necrosis of the liver (14,4). As a result of decreased blood flow to the liver, hyperbilirubinemia is frequently seen along with elevated levels of the liver enzymes alkaline phosphatase (ALP), sorbitol dehydrogenase (SDH), gamma-glutamyl transpeptidase (GGT), and aspartate aminotransferase (AST) (5,11,15). In addition, acute renal failure was observed by Adam et al. (16); histopathological investigation has revealed renal tubular necrosis with hemoglobin casts and reticuloendothelial cell growth in the kidney, liver, lymph nodes, and lungs (2,4); renal insufficiency can result in azotemia and abnormalities in urine consistent with changes in kidney function; pigmenturia produced by either hemoglobinuria or bilirubinuria occurs with significant systemic involvement concurrent with continuous hemolytic events (17); the variable differences in biochemical parameters reported by different studies can be attributed to the T. equi infection disease (4,11), and these biochemical parameter changes may be useful in the evaluation of the prognosis and treatment of theileriosis.
The Egyptian Arabian stallion breed improves other horse breeds and provides the world's most expensive, finest, and purest horse breed. So, this study aims to determine the prevalence of T. equi in Arabian stallions in Egypt by ME and cPCR and evaluate the changes in liver and kidney function of infected stallions to decrease economic losses from this disease.
Materials and method
Ethical approval
This investigation was conducted according to standard protocols, with no horse pain or injury. Additionally, the experiments' procedures were approved by the Ethics Committee of the Veterinary Medicine Faculty, Benha University, Egypt (BUFVTM 08-10-23).
Animals and location
This study, which involved 100 Arabian stallions aged 3 to 15, was conducted in Cairo, Egypt, between September 2022 and August 2023. Each stable had a bed of rice straw, water, and mineralized salt. Stallions feed grains twice a day and forage three times a day. The stallions were released into the yard daily and exposed to daylight. Every stallion had a vaccination and deworming program and was used for breeding. Clinically, while some horses were healthy, the majority were emaciated and exhausted. Horses also had a history of being affected by ticks.
Blood collection and microscopic examination
Following the technique, one hundred blood samples were taken from each stallion from the jugular vein and put into two sterile vacuum biochemistry tubes. Then, they were brought to the laboratory in the cold chain. The first tube, the EDTA K2/K3 tube (lavender-top tube), was used right away to generate thin blood smears, which were subsequently fixed with absolute methanol, stained with Giemsa, inspected for T. equi evidence under a light microscope; these samples of whole blood were preserved at -20ºC until molecular analysis (cPCR). The second tube, no additive (Red Cap Plain tubes), was centrifuged by a compact centrifuge (HERMEL Z 206 A, Germany) for serum samples at 3000 rpm for 10 minutes after the blood was allowed to coagulate at room temperature; these serum samples were stored at -20ºC until biochemical parameter estimation. Once T. equi were detected in all samples, we divided the stallions into two groups: the first group (n = 30) was an infected group (positive T. equi by microscopic and cPCR), and the second group (n = 10) was healthy (negative T. equi by microscopic and cPCR). We then evaluated total protein, albumin, bilirubin, ALP, GGT, AST, urea, and creatinine for both groups (infected and healthy) from serum samples.
DNA extraction
The QIA amp DNA Mini kit (Qiagen, Germany, GmbH) was used to extract DNA from blood samples, with certain modifications made by the manufacturer's instructions. In summary, 10 µl of proteinase K and 200 µl of lysis buffer were added to 200 µl of the sample suspension and incubated for 10 minutes at 56 °C. Following incubation, the lysate was mixed with 200 µl of 100% ethanol. The manufacturer's instructions were then followed for washing and centrifuging the sample. 100 µl of the elution buffer in the kit was used to elute the nucleic acid.
Oligonucleotide Primer
The primers used by Metabion in Germany are mentioned in table 1 (16).
Table 1: Primers sequences for theria 16S rRNA
|
Primers sequences
|
Size (bp)
|
|
CATCGTTGCGGCTTGGTTGG
|
664
|
|
CCAAGTCTCACACCCTATTT
|
PCR amplification
A 25 µl reaction comprising 12.5 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer at a concentration of 20 pmol, 5.5 µl of water, and 5 µl of DNA template was used to use the primers. A 2720 thermal cycler from Applied Biosystems was used to carry out the reaction.
Analysis of the PCR products
The PCR products were separated by electrophoresis employing gradients of 5V/cm on a 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature. 15 µl of each product was put into a gel slot for gel analysis. The fragment sizes were measured using a generuler 100 bp ladder (Fermentas, Germany). A gel documentation system (Alpha Innotech, Biometra) took pictures of the gel.
Biochemical studies
Kits for measurement of Total protein, Albumin, Bilirubin (Total and direct), ALP, GGT, AST, Urea, and Creatinine were obtained from Centronic GmbH, Germany.
Statistical analysis
The results data were examined by using the program Statistical Package for the Social Sciences (SPSS) version 26.0 (IBM Corp., Chicago, USA. Significant results levels (at levels p≤0.05) indicated a potential risk of infection.
Results
Microscopic examination and cPCR
Under a microscope, giemsa-stained blood smears from stallions revealed intra-erythrocytic, rather small, less than 2 μm long, pear- and ring-shaped T. equi merozoites. These four pear-shaped T. equi merozoites form a tetrad called the maltese cross in the erythrocytes. Theilerial schizogony forms, which are irregularly shaped structures called macroschizonts or microschizonts that contain tiny chromatin granules, were disclosed by lymphocytes (Figure 1). Of the 100 blood samples from Arabian stallions tested for T. equi infection, 38% (38/100) were positive by cPCR (Figure 2) and 30% (30/100) by microscopic examination (Figure 1). The prevalence of T. equi determined by molecular assay (cPCR) was significantly higher (P<0.000) than the microscopic examination (ME) (very strong) (Table 2).
Figure 1: Blood smear of an equine infected with Theileria equi, stained with Giemsa: (A) Theileria schizogony forms in lymphocyte and (B) merozoites in erythrocyte.
Figure 2: Agarose gel electrophoresis of PCR (664 bp) is specific for the characterization of Theileria equi. Lane L: 100 bp DNA marker. Lane P: Positive control for T. equi gene. Lane N: Negative control. Lanes 1,6,7 and 9: Negative T. equi DNA. Lanes 2, 3, 4, 5, 8 and 10: Positive T. equi DNA.
Table 2: The prevalence of Theileria equi infection in arabian stallions by microscopic examination and cPCR
|
Methods
|
Examined stallions (n)
|
Positive samples (n)
|
Negative samples (n)
|
Prevalence (%)
|
|
Microscopic
|
100
|
30
|
70
|
(30%)
|
|
cPCR
|
100
|
38
|
62
|
(38%) ***
|
*** Subscript significance differences between between the same columns (***P<0.05).
Biochemicals parameters
It was found in our study that in Arabian stallions naturally infected with Theileria equi, bilirubin (total, direct, and indirect), AST, GGT, urea, and creatinine statistically significantly increased; however, total protein, albumin, and globulin statistically significantly decreased compared to the healthy group (P<0.05). It was found that, compared to the healthy group, variations in the ALP and albumin: globulin (A: G) ratio in Arabian stallions naturally infected with T. equi were not statistically significant (Table 3).
Table 3: Biochemical changes in arabian stallions infected with Theileria equi and healthy Arabian stallions
|
Parameter
|
Group
|
P Value
|
|
Healthy (A) n=10
|
Infected (B) n=30
|
|
Total bilirubin (mg/dl)
|
1.08±0.11
|
1.52±0.06**
|
0.001
|
|
Direct bilirubin (mg/dl)
|
0.49±0.09
|
0.74±0.03**
|
0.002
|
|
Indirect bilirubin (mg/dl)
|
0.61±0.07
|
0.76±0.03*
|
0.038
|
|
ALP (U/L)
|
276.10±30.05
|
223.67±14.4
|
0.092
|
|
GGT (U/L)
|
14.50±1.72
|
22.97±1.30**
|
0.001
|
|
AST(GOT) (U/L)
|
213.4±4.16
|
234.2±2.26***
|
0.000
|
|
Total protein (g/dl)
|
6.51±0.14
|
4.47±0.09***
|
0.000
|
|
Albumin (g/dl)
|
3.37±0.12
|
2.32±0.06***
|
0.000
|
|
Globulin (g/dl)
|
3.14±0.08
|
1.63±0.17***
|
0.000
|
|
Albumin: Globulin ratio
|
1.08±0.05
|
0.83±0.09
|
0.112
|
|
Urea (mg/dl)
|
19.60±0.87
|
30.43±0.45***
|
0.000
|
|
Creatinine (mg/dl)
|
0.62±0.04
|
1.46±0.05***
|
0.000
|
*, **, *** Subscript significance differences between rows; *P<0.05 (Moderate significant), **P<0.01 (Strong significant) and ***P<0.001 (Very strong significant).
Discussion
Arabian horses have travelled the world via trade and warfare throughout history, where they used Arabian stallions to improve other horse breeds by adding speed, refinement, endurance, and strong bone. Theileria equi is a blood parasite disease spread by ticks that is endemic in Egypt (17). It causes piroplasmosis, also known as theileriosis, affecting the Arabian stallions' performance and horse industry. Since Arabian stallions are a highly prized breed in Egypt, this study aims to ascertain the prevalence of T. equi by using cPCR and microscopic examination (ME), respectively, and to compare their prevalence. Additionally, it seeks to assess how T. equi affects the liver and kidney function of Arabian stallions by measuring total bilirubin, direct bilirubin, indirect bilirubin, ALP, GGT, GOT (AST), total protein, albumin, globulin, albumin: globulin (A: G) ratio, urea, and creatinine levels, which in turn affect the performance of stallions.
The prevalence of T. equi by ME in the current study (30%) was higher than the prevalence found by ME in Egypt by Mahdy et al. (18) 27.4% and Kuraa et al. (7) 14%. In addition, the prevalence was also higher than some other countries found, like Ethiopia 12.2% by Gizachew et al. (19) and Costa Rica 24.6% by Posada-Guzmán et al. (20). In the present study, cPCR detected that the prevalence of T. equi-infected Arabian stallions in Egypt was 38%, which was higher than Mahmoud et al. (21) 36.4%, and lower than that detected by Mahdy et al. (18) 60.8%; however, it was the same result as Kuraa et al. (7) 38%. In comparison with some other world countries, the prevalence of T. equi-infected Arabian stallions in our study was higher than that reported by Osman et al. (22) in Sudan 13.9% of horses and Sumbria et al. (23) in India 14.14% of horses, less than Habibi et al. (24) study 96.77% of healthy horses and mules in Iran and Sgorbini et al. (25) study in Italy 41% of horses, and nearly the same as Ahedor et al. (10) study in Paraguay 38.14%. Different prevalence observations have been reported from various areas of the world due to factors such as the variations in the sensitivity of different diagnostic tests used in different epidemiological studies, the presence and abundance of competent tick vectors, the activity of the host, management practices, and the effectiveness of vector control programs (4).
ME is most helpful when an equine has an acute T. equi infection; cPCR, on the other hand, is the most sensitive approach for diagnosing animals with a chronic T. equi infection. However, to ensure that the prevalence result of ME in our study differed from previous studies and that cPCR was higher in the prevalence study than ME due to cPCR's greater sensitivity and accuracy (26,27), careful examination of the smear is necessary, necessitating an experienced operator to prevent false-negative results.
Numerous studies have examined risk factors, including age, sex, breed, animal species, castration status, tick presence or absence, location, origin, and activity (1,28). These factors, which impact the frequency of T. equi infections, can be categorized as extrinsic/environmental or intrinsic host-related (4). Al-Ani and Yousif (29) found the prevalence of Babesia caballi higher in Arabian horses than in Thoroughbreds and Crossbreds. Moretti et al. (30) found that T. equi persists with increasing age; they also found a relation between the breed and the rate of piroplasmosis seropositivity. Piroplasmosis was found to be more prevalent in males than females in many studies, as in cattle with Theileria species (31) and equine with Babesia caballi (32,29); sex hormone levels have been linked to susceptibilities to T. equi infection and mice used in experiments showed that higher testosterone levels made them more susceptible to piroplasmosis infection and tick infestations (33,34). In general, the prevalence in our study differed from that of other studies conducted in Egypt, possibly due to several factors, such as age (adult horses ranged from 3 to 15 years old), breed (Arabian horses), sex (stallions), and location (Arabian horses were found in Egypt).
The current investigation revealed that infected Arabian stallions had significantly increased serum bilirubin (total, direct, and indirect) levels. This notable rise in bilirubin levels may be caused by hemolysis and hepatic dysfunction of parasite erythrocytes (6). Various investigations reported an increase in total bilirubin levels (35,11) or no change in levels (36). Takeet et al. (37) also noted decreased direct bilirubin levels. Decreased blood flow to the liver with T. equi infection causes hyperbilirubinemia, which is frequently seen along with elevated levels of liver enzymes (15,5,11). In our investigation, blood levels of liver-specific enzymes (AST and GGT) were significantly higher in infected stallions with T. equi infection than in healthy stallions; however, ALP levels remained unchanged. Studies have reported that hepatocyte damage caused by hypoxia related to anemia may cause this increase in enzyme activity (15,5). The higher level of unconjugated bilirubin resulted in raised liver enzymes; liver enzyme levels rose as a result of the ongoing hemoglobin release and the creation of unconjugated bilirubin, as well as the liver's limited ability to conjugate bilirubin (38). Furthermore, other investigations found that theileriosis infections in horses did not alter liver enzyme levels (37,39).
According to Bozukluhan et al. (40), acute phase protein response (negative acute phase protein) and/or liver dysfunction are considered to be the causes of the reduction in albumin level. Extensive protein breakdown occurs during T. equi infection due to digestive disruption and protracted fever (41). Major laboratory results in this state include hypoproteinemia, hypoalbuminemia, and hypoglobulinemia, as found in our study; however, the albumin: globulin (A:G) ratio has not changed. This hypoproteinemia is also expected when there is a reduction in body weight due to fat and muscle mass (Cachectic states) (42). This was also found in other studies on T. equi infection, such as those conducted by Al-Obaidi et al. (15) and El-Sherif et al. (5). Studies by Zaeemi et al. (35) and Özdek et al. (11) found an increase in albumin and protein.
In our work, T. equi infection causes hemoglobin-induced pigment nephropathy, and systemic reactions of severe inflammation increase urea and creatinine (2). Renal insufficiency can result in azotemia and abnormalities in urine consistent with changes in kidney function with T. equi infection; pigmenturia produced by either hemoglobinuria or bilirubinuria occurs with significant systemic involvement concurrent with continuous hemolytic events; finally, increases in urea and creatinine parameters, which were found by Mohammed et al. (17) and Ahmadpour et al. (12) and agree with our study; on the other hand, Özdek et al. (11) did not find alteration statistically significant in urea and creatinine. The differences in studies may vary according to the stage of infection, either acute or chronic.
Conclusion
Theileri equi prevalence in Arabian stallions in Egypt is 30% by microscopic examination (ME) and 38% by cPCR. Total bilirubin, direct bilirubin, indirect bilirubin, gamma-glutamyl transpeptidase (GGT), aspartate aminotransferase (AST or GOT), urea, and creatinine levels increase with T. equi infection in Arabian stallion; otherwise, total protein, albumin, and globulin decrease. There was no alteration of alkaline phosphatase (ALP) and albumin: globulin (A: G) ratio levels with T. equi infection in Arabian stallions. Accurate diagnosing T. equi infection helps correct treatment while being aware of the prognosis. More studies are needed to understand the role of immunity in the pathophysiology of theileriosis and how to decrease its prevalence.
Acknowledgment
The authors acknowledge the financial support provided by the STDF application form for the postgraduate support grant (PSGS) ID: 48715, titled Effect of growth factor on in vitro maturation of equine oocytes. This work was done in the Embryo and Genetic Resources Conservation Bank at the National Research Centre.
Conflict of interest
The authors affirm that they do not have any conflicts of interest.