Introduction
Dogs on the loose are a major reservoir for disease, particularly in Asian countries where the populations are notoriously free of management and represent serious public health risks (1,2). These are the animals who are vectors of various disease viruses for people and other animals, thereby contributing to outbreaks of zoonotic diseases. Out of all these organisms, intestinal parasites are especially worrisome, being very transmissible and capable of causing severe gastrointestinal damage in infected patients. The scourge of this public health problem is made worse by the stray dog populations in both cities and rural communities where low levels of veterinary care and saline provide ideal conditions for the growth of these parasites (3). These are parasites that cause all kinds of gastrointestinal disorders, some of which are life-threatening (4). Coccidiosis is a protozoal disease of the family Eimeriidae that is endemic to wild animals as well as domesticated ones with a high contagiousness rate and spread throughout the animal kingdom (5). Vomiting, abdominal pain, inappetence, anorexia, thirst and diarrhea (sometimes bloody feces) are the symptoms of coccidiosis (6,7). Usually, the diagnosis of coccidiosis is made using these clinical symptoms and the detection of Isospora oocysts in stools (8). It’s a severe illness, particularly in younger or immunocompromised animals, where infection can result in serious complications or death (6). There are a few coccidian parasites that infect dogs, Isospora spp. are the most frequent (9). Within this genus, Cystoisospora spp. are apicomplexan protozoan parasites that cause disease in dogs with a global prevalence of 1-5% (10,11). Cystoisospora infections, while usually ruled nonpathogenic, are sometimes clinically relevant, especially in the context of diarrhea where they are particularly prevalent (12). Also, new Isospora species have kept our knowledge of the genus growing, more than 248 species have been named since 1986 (13). That makes the future urgently in need of new diagnostic and epidemiological research to detect and describe new species (14). At the molecular level, the ribosomal DNA (rDNA) molecule is an important genetic tag since it is involved in the formation and function of ribosomes. rDNA primary and secondary structure is so well conserved in many taxa that it’s a goldmine for phylogenetic analysis. These preserved structures help to align rDNA sequences precisely, so scientists can make strong phylogenetic inferences. By looking at regions of the rDNA molecule, scientists can check for evolutionary correspondences and to better map parasite diversity and category. This molecular technique is now a standard tool in Cystoisospora spp. research, allowing strains to be more precisely identified and categorized, and understanding their evolutionary history (15).
The current study aimed at finding out about the presence and molecular features of Cystoisospora among homeless dogs in Al-Diwaniyah province in Iraq.
Materials and methods
Ethical approve
The study was ethically approved by the Committee of Research Ethics in the College of Veterinary Medicine, University of Al-Qadisiyah issued 1890, dated on August 28, 2023.
Sample collection
They used 200 fecal samples from stray dogs of both sexes and different ages. Samples were collected from dogs directly according to the protocols (16). All samples were in labelled plastic boxes for identification and contamination. The samples were kept in a cooler after they had been collected so that they would be preserved during transport to the research laboratory at the College of Veterinary Medicine. Once in port, the samples were thawed for analysis.
Coprological examination
Both fecal specimens were coprological tested by flotation and sedimentation for Cystoisospora spp. The samples were floated for Cystoisospora oocysts. A beaker filled with about 4-5 g of excrement, filled with tap water. It was then passed through a sieve to remove large pieces of debris, and the filtrate transferred to new 15 ml test tubes. The tubes were centrifuged for 3 minutes at 1000 rpm and the supernatant thrown away. Sheather’s sugar solution was added to the sediment, muddled and centrifuged at the same speed for 5 minutes more. A drop of the floating film was tapped down with a pipette, applied to a microscope slide, and covered with a cover slip. The slides were inspected at 10x and 40x magnification with a microscope for Cystoisospora Oocysts (12).
Molecular study
A molecular analysis confirmed the Cystoisospora canis in the fecal samples, and phylogenetic tree was built. This was genomic DNA extraction, DNA quantification, PCR and primer construction (17).
Genomic DNA extraction
Genomic DNA was taken from the faecal fluid using AccuPrep® Stool DNA Extraction Kit (Bioneer, Korea). It was run as the manufacturer instructed to obtain quality DNA for downstream molecular analyses (17).
Genomic DNA estimation
We measured the concentration and purity of the isolated DNA with a Nanodrop spectrophotometer (THERMO, USA). Pure DNA was measured by 260 nm and 280 nm absorbance for good quality to amplify by PCR (17).
Polymerase chain reaction
The PCR was done on the fecal samples to find Cystoisospora canis DNA. We amplified with a thermal cycler as per the instruction manual for the kit manufacturer. This process was a series of denaturation, anneals and extension to amplify target sequences unique to Cystoisospora canis (17).
Primers
The primers (F: CCTCTGGAAGGGCAGTGTTT and R: TGCCGGAATTTCACCACGTA; 511bp) for the Cystoisospora 18S ribosomal RNA gene (badger isolate 02/04964) were constructed using NCBI Gene database. They were created by Bioneer Company (Korea). The primers were tuned for sensitivity and efficiency for Cystoisospora canis detection from fecal DNA.
Results
By flotation of 200 fecal samples, 19% of the fecal samples were positive for Cystoisospora oocysts. The other, 81% of samples were Cystoisospora Oocyst-free, indicating no infection in most of the studied population, they indicate the prevalence of Cystoisospora in the sample (Figure 1 and Table 1). Table 2 shows the prevalence of Cystoisospora parasite among 106 males examined recorded low infection rate 16.03% while the prevalence among 94 female dogs examined recorded high infection rate 22.34%, and the total infection rate was 19%. Table 3 show higher prevalence of Cystoisospora sp. was recorded in Puppies 71(38.02%) as compared to adult group 129 (8.52%).
Figure 1: Oocyst of Cystoisospora spp.
Table 1: Overall prevalence of Cystoisospora in dogs
|
Status
|
Number (%)
|
|
Infected
|
38 (19%)
|
|
Not infected
|
162 (81%)
|
|
P value
|
0.001*
|
* Significant difference
Table 2: Cystoisospora sp. prevalence with sex
|
Sex
|
Examined n
|
Infected n(%)
|
|
Male
|
106
|
17 (16.03)
|
|
Female
|
94
|
21 (22.34)
|
|
Total
|
200
|
38 (19.00)
|
|
P value
|
0.307
|
* Significant difference
Table 3: Cystoisospora sp. prevalence with sex with age
|
Sex
|
Examined n
|
Infected n(%)
|
|
Puppies
|
71
|
27 (38.02)
|
|
Adults
|
129
|
11 (8.52)
|
|
Total
|
200
|
38 (19.00)
|
|
P value
|
0.00001*
|
* Significant difference
PCR results
Using PCR analysis, Cystoisospora spp. Was detected in 56% (17 out of 30) of the fecal material from dogs. The probes were detected with specific primers against the 18S rRNA gene that amplified a 511 bp segment. The PCR products were electrophoresed on an agarose gel and Cystoisospora DNA was found in the positive samples (Figure 2).
Figure 2: Agarose gel electrophoresis image shows the PCR product analysis of DNA extracted from fecal samples of stray dogs, where Lane M: ladder (2000-100bp), lanes 3, 4, 5, 7, 10, 13, 14, 15, 17, 18, 21, 22, 24, 25, 27, 28, and 29 show positive Cystoisospora spp. at 511bp PCR product size.
DNA sequencing and phylogenetic tree construction
The local Cystoisospora spp. isolates collected during this research were submitted to NCBI GenBank database, with accession numbers assigned to each sequence (Table 4). The full sequence reads of the 18S rRNA gene were used to confirm all four isolates as Cystoisospora canis. This genetic identification is robust confirmation of the species-level classification, enabling confidence in the molecular results. Phylogenetic analysis of the evolutionary relationships was done using MEGA version 6.0, a popular tool for molecular evolutionary analysis. The tree generated from this study showed that all the isolates of Cystoisospora canis reported here were phylogenetically related to an earlier identified Cystoisospora canis isolate from Canada (entirely known from NCBI GenBank accession number KT184362.1). The local isolates shared 100% sequence identity with this Canadian reference strain, which is high genetic homology, and implies the potential for this gene to be conserved in different geographical locations (Figures 3 and 4).
Table 4: NCBI-BLAST Homology Sequence identity (%) between local Cystoisospora canis isolates and NCBI-BLAST submitted Cystoisospora canis isolates
|
Cystoisospora canis isolate
|
GenBank Accession number
|
GenBank Accession number
|
County
|
Identity (%)
|
|
Isolate number 1
|
MK967970
|
KT184362.1
|
Canada
|
100%
|
|
Isolate number 2
|
MK967971
|
KT184362.1
|
Canada
|
100%
|
|
Isolate number 3
|
MK967972
|
KT184362.1
|
Canada
|
100%
|
|
Isolate number 4
|
MK967973
|
KT184362.1
|
Canada
|
100%
|
Figure 3: Multiple sequence alignment between local Cystoisospora canis isolates obtained here and Cystoisospora canis small subunit ribosomal RNA (18S rRNA) gene sequences of these local isolates and Cystoisospora canis were also performed. NCBI GenBank database). Alignment was done using the ClustalW alignment utility that is part of MEGA version 6.0, an internationally accepted molecular sequence analysis software. Alignment yielded high levels of nucleotide agreement across the sequences as you can see with conserved areas displaying an asterisk (*).
Figure 4: Phylogeny tree from the partial sequence of the small subunit ribosomal RNA (18S rRNA) gene to genetically classify Cystoisospora species. The tree was drawn by Unweighted Pair Group Method with Arithmetic Mean (UPGMA) of MEGA 6.0. It was found that the local isolates of Cystoisospora (No. 1 to No. 4) closely matched an NCBI-BLAST isolate of Cystoisospora canis (accession number KT184362.1).
Discussion
Dogs across the world are infected with cystoisospora and the only way to diagnose this parasitic disease is by finding oocysts in their feces. Genus Cystoisospora species have long been identified by their oocyst shapes. But such morphological species-level identifications are limited, and molecular methods now permit species-level identification (17).
In this work, by Flotation, 19% (38/200) of fecal samples taken from abandoned dogs tested positive for Isosporiosis. It is not more prevalent than other geographical areas. In a disagreement with the current study finding, in the Hantana district in Sri Lanka, for example, the prevalence was 76.7%, compared to 21.4% in Baquba City in Iraq (18,19). These geographical differences in prevalence might be explained by differences in climate, weather conditions (temperature and humidity), diet, immune function and sanitation. Areas that are hot and humid, for instance, are more likely to support and sporulate Cystoisospora oocysts, potentially increasing infection (17).
We found that the present study showed more Isosporiosis in female dogs 22.34% than in male dogs 16.03%. This matched a study from Hantana district which found 100% in female stray dogs (18). This higher incidence in women could be explained by hormonal and physiological differences and even possible exposure in a reproductive cycle, when immune system may temporarily be turned off.
Old age was the major determinant of infection rates and puppies had much higher rates 38.02% than adults 8.52%. Other researchers have seen similar findings with up to a 100 per cent rate in puppies under 1 year old (18). The puppy rate is high because the mother’s poop may contain infective oocysts, and dogs often ingest it. Puppies are usually low in immune systems and therefore more vulnerable to infection. It’s one reason that proper sanitation and control are so important to avoid spreading in young animals (12).
This was the first molecular analysis of Cystoisospora canis performed in Iraq, and it adds information to the parasite’s worldview. The species identification was carried out by microbial methods including PCR using the 18S rRNA gene. This method corresponds with the findings in Japan, where Cystoisospora detection using the 18S rRNA gene has proven successful (20). Molecular phylogenetics can be particularly useful to gain a view of evolutionary relationships among taxa and identify host-parasite relationships that are hard to see from morphology alone (21).
When the phylogenetic data for this research was presented, local Cystoisospora canis isolates were identified as part of a unique clade of canine hosts. We BLASTed the 18S rRNA gene sequences to detect 100% match between the local isolates and an earlier reported Cystoisospora canis isolate from Canada (GenBank accession no. KT184362.1). This striking genetic homology also suggests that there is little genetic variation among Cystoisospora canis populations (regardless of location). These isolates grouped in the same node may result from the parasite being carried over regions by paratenic hosts (rodents, birds, etc) (22-30).
The microbial techniques can now be used to obtain accurate species-level identification and provide better information on the diversity of these parasites. Those variation in prevalence will probably depend on factors in the environment: climate and weather conditions, such as temperature and humidity, diet, immune status and sanitation (31-36). The warmer, moister climates, for example, could favor the sporulation of Cystoisospora oocysts and thus the chances of infection. In addition, this current study found that Isosporiosis was more common in female dogs 22.34% than in males 16.03%. This higher incidence in females might be due to hormonal and physiological variations, especially in reproductive years when the immune system can be temporarily shut down. Other factors that influenced infection were age. This is also the first molecular examination of Cystoisospora canis performed in Iraq and reveals something new about the genetic variation and evolutionary history of the parasite (37-44).
Conclusion
The results of this research demonstrate the value of molecular methods such as PCR and phylogenetics in determining the right Cystoisospora species and their evolutionary relationships. The minimal genetic difference among Cystoisospora canis isolates in different regions imply that the 18S rRNA gene is highly conserved and a sound species-hunting candidate. And phylogenetic analysis can tell us about parasite migrations and inter-regional connections made by wildlife. All these findings make it imperative to integrate molecular techniques into parasitological studies and surveillance to further improve parasite ecology and epidemiology.
Acknowledgments
The authors would like to thank the College of Veterinary Medicine, University of Al-Qadisiyah.
Conflict of Interest
There is no conflict of interest for the current work.