Introduction
Worldwide, stray dogs have been the main origin of infectious agents and zoonoses such as cutaneous and hemoparasites (1-5). In recent years, Hemotropic mycoplasmas, (canine hemoplasmosis), are unique bacteria that are small uncultivable and lack a cell wall, which differentiates them from other bacteria (6-8), these pleomorphic bacteria afflict erythrocytes, have been increasingly announced in man and various animal classes (9-11) resulting in different level of anorexia, hemolytic anemia, febrile, motor incoordination, splenomegaly, laziness, jaundice, dehydration, emaciation, and unexpected death (12-14). Although the transmission of hemoplasmas is still poorly understood, they are transmitted through fighting, blood transfusion, contaminated fomites and transplacentally, lactation, and ectoparasites (Lice, fleas, and ticks) from apparently healthy carrier dogs to another animal (15,16). Canine hemoplasmosis is most often symptomless; however, hazardous or lethal illness can occur in immunosuppression dogs. Additionally, the incidence of demodectic mange was associated with canine hemoplasmosis (17). The diagnosis of hemoplasmas microorganism and based on typical clinical symptoms of hemolytic anemia and reveals the presence of microorganisms in traditional stained blood smears. However, artifacts like Howell-Jolly bodies and other surrounding ruins, together with cytology efforts unable distinguishing distinct types of hemoplasmas and consequently low diagnostic sensitivity and specificity (18,19). Different molecular techniques are currently widely employed for detecting and differentiating hemoplasma (20,21). Stray dogs, due to their constant exposure to the environment and potential contact with various pathogens, pose a significant public health risk (23). Epidemiological studies conducted globally have revealed varying prevalence rates of canine hemoplasmosis, ranging from 0.6 to 56.8%.
However, there has been no research conducted in Mosul city to explore the presence of hemotropic mycoplasma in stray dogs, So the purpose of this study is to analyze a molecular detection of this pathogen and some related links to the causative agent in Mosul city, Iraq.
Materials and methods
Ethical approve
The Institutional Animal Care and Use Committee issued IACUC/UM.Vet.2023.026, dated at 15th February 2023 to license this study.
Animal sampling and laboratory tests
The sampling was carried out in Mosul, a significant city in northern Iraq, strategically positioned along the Tigris River. As the capital of Nineveh Governorate, Mosul is not only an urban hub but also a region of considerable historical and cultural relevance. Geospatially, the city is located at coordinates approximately 36°2′N latitude and 43°7′E longitude, offering a unique setting for the study. During the period between March2022 to March 2023, 100 stray dogs (50 male dogs, 30 bitches, and 20 puppies) were randomly selected from different area in Mosul city. However, the majority of animals were apparently clinically normal; some of those animals were emaciated and had pale mucous membranes and /or skin lesions. Blood specimens were obtained from the cephalic vein and placed into an EDTA tube and frozen at -20°C until use (13).
Molecular technique
Blood specimens were handled and equipped according to g SYNC™ DNA Extraction Kit (Korea). The obtained DNAs were then checked for their concentration (ng/µl) and purity using the NanoDrop spectrophotometer from Thermo Scientific, UK, with an absorbance measurement at A260/280. This extracted DNA served as the template for subsequent PCR amplification. To proceed with the amplification of the Hemotropic mycoplasmas species gene, Master Mix tubes with a final volume of 20µl were prepared. The target region for detection was the 16S rRNA gene, and the primers used were Myco-F (5'- ATACGGCCCATATTCCTACG -3') and Myco-R (5'- TGCTCCACCACTTGTTCA -3'), as mentioned in the study by (13). The amplification of DNAs was carried out using a conventional PCR-reaction in the Thermocycler System BIO-RAD, USA. The PCR process began with an initial denaturation step at 95°C for 3 minutes. This was followed by 35 cycles, each consisting of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 60°C, and 30 seconds of extension at 72°C. To wrap up, a final extension step was carried out at 72°C for 5 minutes. To analyze the PCR products, electrophoresis was conducted on a 1.5% agarose gel stained with SYBR Safe DNA Gel Stain Thermo Fisher Scientific, USA. The gel was run at 100V and 80 AM for 1 hour. The identification of positive samples for Hemotropic mycoplasmas species. was based on the confirmation of a product size of 618 bp This size indicates the presence of the target gene in the blood samples, and calculated the prevalence of Mycoplasma haemocanis among these groups, using the following formulas: Prevalence = (Sum of positive animals/Total number of dogs)*100.
Statistical analyses
Statistical analysis was accomplished by STATA v.14.0 software. Chi-squared test was used to compared the individual factors (sex, age, and clinical symptoms) with hemoplasma infection. The level of significance was set as P<0.05. The observed prevalence of the Hemotropic mycoplasmas and the 95% confidence intervals (CI) were calculated.
Results
Hemoplasmic PCR was positive in 40 out of 100 dogs (40 and 95% CI= 32.6-46.9%) (Figure 1 and Table 1). Male gender (P<0.05) has a significantly greater prevalence of canine hemoplasmosis (48.3%, 95% CI =32.4-69.4) compared to bitches (27.3 %, 95% CI= 13.4 to 49.2). Also, considerable variance (P<0.05) between dogs infected with Mycoplasma haemocanis as adults (43.8%, 95% CI =30.4-60.9) and puppies (25.0%, 95% CI= 8.1 to 58.3) (Table 1). Result of Mycoplasma haemocanis according to clinical symptoms show that Significant high infection with Mycoplasma haemocanis in asymptomatic dogs (50.9%, 95% CI =33.6 to 74.1) than in animals with symptoms (27.7%, 95% CI =14.7 to 47.3) (Figure 2). A significant infected rate (P<0.05) in emaciated with pale mucous membrane animals 3(20.0%,95% CI =4.1 to 58.5) compared with asymptomatic dogs (Table 2). No significant relationship was not found between molecular-positive animals and skin lesions, and among emaciated dogs (P< 0.05) compared to asymptomatic dogs which show significant differences in infection without appearing any clinical signs (Table 2).
Figure 1. Agarose gel electrophoresis image that showed the PCR product analysis of 16s ribosomal RNA gene in Mycoplasma haemocanis from extracted DNA of blood dog's samples. Where M: marker (1000-100bp) and the Lane (2-4) positive Mycoplasma haemocanis samples at (618bp) PCR product, P: positive control, N: negative control.
Table 1: Molecular prevalence of Hemoplasma canis in stray dogs
|
Factors
|
Samples (n)
|
PCR positive n(%)
|
P value
|
|
Sex
|
|
Male
|
60
|
29(48.3)
|
< 0.01
|
|
Bitches
|
40
|
11(27.3)
|
|
Age
|
|
Adults
|
80
|
35(43.8)
|
< 0.01
|
|
Puppies
|
20
|
5 (25.0)
|
Figure 2: Distribution of Molecular Prevalence of Hemoplasma canis infection in stray dogs according to clinical symptoms in Mosul city, Iraq.
Table 2: Molecular prevalences of hemoplasma canis infection in stray dogs based on clinical symptoms in Mosul city, Iraq
|
Symptoms
|
Examined dogs (n)
|
Positive n(%)
|
x2
|
P value
|
|
Skin lesions
|
15
|
5(33.3)
|
3.411
|
0.0648
|
|
Emaciated
|
17
|
5(29.4)
|
4.893
|
0.0270
|
|
Emaciated with pale mucous membrane
|
15
|
3(20.0)
|
7.527
|
0.0061
|
|
Asymptomatic dogs
|
53
|
27(50.9)
|
References
|
|
|
Total
|
100
|
40
|
|
|
Discussion
The outcomes of these study studies revealed a significant prevalence of Hemotropic mycoplasma in the sampled stray dogs, with an overall infection rate of 40%. This finding highlights the serious consequences of stray dog populations on public health, as these animals can act as reservoirs and potential sources of transmission for Hemotropic mycoplasma to humans and other susceptible species. The higher prevalence of canine hemoplasmosis recorded in this study was identical to data from in Portugal 40% (24) and, in Turkey 38.3% (25). The high frequency of canine hemoplasmosis were was reported in Brazil (26), Turkey (27), Australia (28), Southern Brazil (29) and Sudan (30), respectively. Whereas slighter prevalence rates were documented 23% in Iran (31), 15.7%, in Saudi Arabia (32), 4.5% in Italy (33), 7.7% in Nigeria (34), and 1.3% in the USA (35).
The variances of distribution between areas can be clarified by geographical dissimilarity dissimilarities, such as weather, vector spreading, and analytical procedures (molecular tools versus microscopical detection), or a combination of all of them, resulting in disagreements among scientific researches researchers. Another possible explanation for the higher prevalence could be that the stray dogs are not regularly vaccinated and may not receive regular veterinary care, hemoplasma infections can go undetected and untreated for long periods of time. This can lead to the spread of the bacteria to other animals.
The commonness of Hemotropic mycoplasma was significantly larger in males and adults in comparison to bitches and puppies respectively. This result is in agreement with the newly new research, which informed hemoplasmas to be more predominant in adult dogs (22,24,36). This may result from prolonged times of exposure to microorganisms as dogs age, as well as increasing exposure to the outside environment. These factors may have elevated the incidence of Hemotropic mycoplasma infection in both male and adult dogs (24). Despite the fact that even though Barbosa et al. (37) found that gender did not statistically significantly affect the spread of Hemotropic mycoplasma infection to dogs in their study. Yüksel et al. (27), recorded Hemotropic mycoplasma at rate 25% and 27% in bitches and male dogs respectively.
A high significant infection rate with Mycoplasma haemocanis was recorded in asymptomatic dogs than in animals with symptoms and also in emaciated with pale mucous membrane animals compared with asymptomatic dogs. The clinical manifestations of canine hemoplasmosis, vary from asymptomatic to anemia, anorexia, lethargy, dehydration and loss of body weight to sudden death (12,33). Mycoplasma haemocanis, plays a significant role in the development of anemia in dogs through Mycoplasma haemocanis attaches to red blood cells, causing immune-mediated destruction and blood hemolysis leading to anorexia, lethargy, emaciation and pale mucous membranes (7,8).
Further scientific records informed that there is no significant relation among anemia and hemoplasmosis (33,38). While, Yüksel et al. (27), observed that 8 (66.6%) of the samples revealed Hemotropic mycoplasma in the anemic dogs, whereas the remaining 4 (33.4%) samples did not. Additionally, Hemotropic mycoplasmas were identified in the blood of dogs that appeared to be normal using molecular techniques (25-40).
Conclusion
The molecular survey conducted in Mosul city, Iraq, reveals a substantial prevalence of hemotropic mycoplasma in stray dogs, emphasizing the need for effective control procedures to diminish the spread of risk to humans and other animals. Stray dog populations should be a focus of public health efforts, including regular monitoring, vaccination campaigns, and population control measures. Furthermore, educating the local community about the risks and transmission mechanisms of hemotropic mycoplasma is crucial to ensure a safer environment for both humans and animals alike.
Acknowledgement
The author is grateful to the University of Mosul, College of Veterinary Medicine for all the facilities to achieve this study.
Conflict of interest
There is no conflict of interest.