Introduction
Single-nucleotide polymorphisms (SNPs) are the most common in eukaryotic and prokaryotic genomes and can be found in genes, mainly in coding and non-coding regions for proteins (1). In the regulated gene regions, many SNPs are often identified and considered (2). However, mutations in the promoter gene region can cause significant alterations in gene expression by changing the binding sites of essential proteins for gene transcription, resulting in changes in traits associated with the gene (3). Follicle-stimulating hormone (FSH) plays an important role in gametogenesis, and its activity is mediated by a specific receptor (eFSHR), which is expressed in granulosa cells and Sertoli cells (4). eFSHR belongs to the superfamily of G protein-coupled receptors and has a crucial role in reproductive efficiency (5). Polymorphisms in the eFSHR gene may be associated with infertility, as observed in male patients, due to amino acid substitutions in the protein structure (6). In female patients, certain polymorphisms are associated with premature ovarian failure (7). Paschalidou et al. (8) evaluated a polymorphism in the eFSHR gene in patients undergoing in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) treatments, associating it with clinical and biochemical characteristics, as well as characteristics related to the ovarian stimulation protocol and pregnancy rates. In animals, a study with sheep reported that a polymorphism in the 3' untranslated region (3'-UTR) plays a vital role in the regulation of transcription of the eFSHR gene (9). Polymorphisms in the 5' regulatory region were strongly associated with litter size in high and low-prolific sheep breeds (10). Another study identified polymorphisms in exon 10 of the eFSHR gene in pigs that are associated with the total number of births (TNB) and the number of live births (NBA) in litters (11). Polymorphisms in the promoter region of the eFSHR gene were identified in laying hens, and they are strongly associated with age at first egg laying and the number of eggs produced up to the age of 43 weeks (12). Kang et al. (13) also evaluated the characteristics associated with an INDEL (Insertion/Deletion) in the promoter region of the eFSHR gene and showed strong associations. Therefore, polymorphisms in the eFSHR gene can serve as excellent molecular markers in assisted reproduction (14). The search for animals with high genetic value and the possibility of utilizing individuals with acquired subfertility has stimulated the development of reproductive techniques in horses, such as artificial insemination, embryo transfer, oocyte transfer, and intracytoplasmic sperm injection (ICSI) (15,16). However, little is known about the genetic factors that affect equine fertility, so genomic studies have been primarily focused on stallion fertility (17,18). Implementing molecular biology techniques in identifying important genes related to economic traits in horses, particularly in selecting animals with high genetic value, has positively influenced the improvement of several horse breeds worldwide (19). Among the various horse breeds, the Quarter Horse (QH) stands out for its versatility and aptitude for various sports (20). It is an adaptable breed that excels in strength, transportation, and competitive performance in equestrian events while also serving as a genetic improver for the overall herd. However, compared to other species, horses still lag in advancements related to reproduction (20).
In this context, the objective of this study was to genetically characterize and identify polymorphisms in the promoter and 5'-UTR regions of the eFSHR gene in QM mares that donate embryos, identify SNPs at binding sites, and associate haplotypes with the number of embryos produced during the 2021 breeding season.
Materials and methods
Ethical approve
The study was approved by the Ethics Committee on the Use of Animals of the Federal Rural University of Amazon (CEUA/UFRA) under the number CEUA 6957170620 ID000213.
Animals
Ninety-two quarter horses (Equus caballus) mares from farms in the states of Pará (n=30), Pernambuco (n=16), and Rio Grande do Norte (n=46) were used. All mares were approximately eight years old and weighed between 400 and 500 kg. The mares were under the technical supervision of veterinarians who managed their reproduction, health, nutrition, and welfare. They were kept under the same sanitary conditions, including multiple annual vaccines, deworming, and ectoparasite control.
Reproductive management
Throughout 2021, all these mares were of the high-performance index in short-distance equestrian events in the regions. Therefore, they underwent assisted reproduction protocols for embryo recovery. Initially, they were evaluated for estrus using transrectal ultrasound to monitor follicular development (references of 35 mm follicular diameter and grade 2 endometrial edema), according to Segabinazzi et al. (21), followed by the induction of ovulation through an intramuscular injection of 1.0 mg of deslorelin acetate per animal. After 24 hours from induction, these embryo donors were inseminated with colled semen (0,1-0,2x109 spermatozoa/mL) from stallions with proven fertility according to the andrology manual of the Brazilian College of Animal Reproduction (22). Embryo collections were conducted 8 days after AI through a uterine flush using 900 to 1000 mL of Ringer's lactate solution, utilizing probes for embryo collection (CH 28 Minitube Brazil) and a collection filter for embryo transfer (Vitrocell Brazil). After the flush, the filter was sent to the laboratory to be evaluated for the presence or absence of an embryo. The recovered embryos were classified by their developmental stage (Morula, Early Blastocyst, or Expanded Blastocyst) and quality (poor, fair, good, and excellent) according to McCue et al. (23) to then be transferred to the recipient mares.
Blood collection
During flushing for embryo collection and counting, vacuum blood sampling was performed from the jugular vein using a 4 mL tube containing EDTA. The samples were labelled, stored in a refrigerated thermal box, and transferred to a freezer at -20°C for further laboratory analysis.
DNA extraction
Blood samples were subjected to genomic DNA extraction using the Phenol-chloroform method developed by Sambrook et al. (24). DNA samples were analyzed for integrity by electrophoresis in a 1.5% agarose gel.
Conventional polymerase chain reactions (cPCR)
cPCR reactions were performed using a pair of primers designed to flank the 5' UTR region and part of the promoter region of the equine eFSHR receptor gene (Equus caballus), based on the sequence deposited in Genbank ID: 100052957. The primers were designed using the Primer3 program available on the website (http://bioinfo.ut.ee/primer3-0.4.0). The primer sequences were as follows: Forward (For): TCCCCACTGAAAACATAGCC position: -319:-300, and Reverse (Rev): AAGGAGACCAGGAGCAAGG position: 365:388. The size of the amplification product was 707 bp. Polymerase Chain Reactions were performed in a final volume of 25 µl using the Master mix kit (Cellco Biotec do Brasil Ltda, São Carlos, SP, Brazil) according to the manufacturer's recommendations, being: 1X of 2X Taq Pol Master Mix, ten pmol/µL of each primer (forward and reverse), 100 ng/µL of genomic DNA. The reactions were carried out in a CFX 96 Thermocycler (BIO-RAD, Hercules, CA, USA) with the following temperature and time conditions: initial denaturation at 95°C for 3 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 62.5°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes.
Purification and sequencing of the PCR product
PCR products (25 µL) were purified using the DNA purification kit on an agarose gel band (Ludwig Biotech LTDA, Alvora, RS, BR) following the manufacturer's recommendations. The purified products were subjected to sequencing reactions using the Sanger method with the BigDye kit (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions, and run on the ABI3500XL DNA sequencer (Applied Biosystem, Foster City, CA, USA).
Alignment of sequences and identification of polymorphisms
The generated sequences were edited using the FinchTV program (Version 1.4.0) developed by the Geospiza Research Team (USA). They were compared with the reference sequence deposited in Genbank ID: 100052957 and aligned for comparison among the animals to detect possible polymorphisms using the Bioedit program (25). The sequence under study was submitted to identify segments as potential binding sites using the AliBaba 2.1 program.
Statistical analysis
The detected SNPs were tabulated and analyzed using the GENEPOP (v.5) program (26). This analysis determined the allelic and genotypic frequencies, the inbreeding coefficients (FIS), and the probabilities for the Hardy-Weinberg equilibrium. Haplotypes with a frequency equal to or greater than 0.05 were tested using the ANOVA test, assuming a model with the haplotype effect and the effects of management (three different farms) and the age of the animals. The PROC MIXED application of the SAS statistics package (OnDemand) was used for the analysis, with a significance level of 0.05.
Results
Three polymorphisms were identified along the studied sequence, two in the regulatory region and one in the 5' UTR region (Figure 1). The first polymorphism (SNP 1) was found at position -217G>T, with the G allele and the GG genotype being the most frequent. SNP 2 was identified at position -195G>A, with the G allele and the GG genotype being the most frequent. SNP 3 was identified at position 127 A>G, with the G allele and the GG genotype being the most frequent. The inbreeding coefficients (FIS) values were positive for all SNPs, indicating possible inbreeding relationships. All SNPs showed deviations from the Hardy-Weinberg equilibrium (p < 0.05) (Table 1). Twelve haplotypes were identified, but only 4 had frequencies greater than 0.05. These haplotypes were evaluated for the number of embryos produced in the 2021 season. The G/G/A haplotype had the highest number of produced embryos, while the G/G/G haplotype had the lowest number. However, there was no significant difference in the number of produced embryos between the haplotypes (p > 0.05) (Table 2). Seventy-four segments were identified as potential binding sites along the 707 bp sequence, including the positions of the identified SNPs. At position -217G>T, two binding segments for Sp1 (Specific Protein 1) and TFAP-2alpha (Transcription Factor AP-2 Alpha) were identified, while at position -195G>A, a binding site segment for GR (Glucocorticoid Receptor) was identified. When evaluating the mutant sequences, the total number of segments was reduced to 71, and some identified sites were lost.
Figure 1: Equine eFSHR Promoter and 5' UTR Sequences. Letters in black represent the promoter region, and letters in blue represent the 5' UTR. Nucleotides highlighted in yellow represent novel polymorphisms. Sequences underlined represent the primers for PCR.
Table 1: SNPs positions and respective statistical descriptions in the eFSHR gene promoter and 5’UTR in quarter horse embryo donor mares
|
SNPs
|
Alleles
|
Freq
|
Genotypes
|
Freq
|
FIS
|
HWP
|
|
SNP1
|
G
|
0.939
|
GG
|
0.902
|
0.0009
|
0.025
|
|
-217G→T
|
T
|
0.061
|
GT
|
0.073
|
|
|
|
|
|
|
TT
|
0.024
|
|
|
|
SNP2
|
A
|
0.104
|
AA
|
0.049
|
0.0003
|
0.003
|
|
-195G→A
|
G
|
0.896
|
AG
|
0.110
|
|
|
|
|
|
|
GG
|
0.841
|
|
|
|
SNP3
|
A
|
0.271
|
AA
|
0.145
|
0.0002
|
0.002
|
|
127A→G
|
G
|
0.729
|
AG
|
0.253
|
|
|
|
|
|
|
GG
|
0.602
|
|
|
|
Total
|
|
|
|
|
|
0.00001
|
SNPs: Single Nucleotide Polymorphisms; Freq: Frequencies; FIS: inbreeding coefficients; HWP: Hardy-Weinberg Probability.
Table 2: Identification of haplotypes from 3 SNPs of the eFSHR gene
|
Haplotypes
|
Frequencies
|
PEN2021 (Average±SD)
|
|
G/A/G
|
0.01
|
|
|
G/G/A
|
0.14
|
0.827±0.541
|
|
G/G/G
|
0.46
|
0.664±0.464
|
|
G/G/GA
|
0.23
|
0.761±0.380
|
|
G/GA/G
|
0.05
|
0.741±0.354
|
|
G/GA/A
|
0.01
|
|
|
G/GA/GA
|
0.01
|
|
|
GT/A/G
|
0.01
|
|
|
GT/G/G
|
0.02
|
|
|
GT/GA/G
|
0.02
|
|
|
GT/GA/GA
|
0.01
|
|
|
T/A/G
|
0.01
|
|
PEN2021: Produced embryos number in 2021; SD: Standard Deviation.
Discussion
The presence of SNPs in the eFSHR gene is commonly observed in various gene regions, including the regulatory region (promoter and 5'-UTR), coding regions, and the 3'-UTR region. This pattern has been observed in different organisms, including humans (8) and production animals such as sheep (9,10), swine (11), and chickens (12,13). This study identifies the first SNPs in the eFSHR gene, mainly in the QM breed. The promoter region exhibited variability, similar to the promoter regions of other genes of reproductive interest, such as the melatonin receptor in buffaloes (27) and the leptin gene in cattle (28).
The high allele frequencies observed in all SNPs indicate a high degree of inbreeding in the mares, as evidenced by the inbreeding coefficients and deviations from the Hardy-Weinberg equilibrium (P<0.05). These high frequencies are directly associated with the selection process employed by the breeders, who prioritize traits of high economic value. Silva-Filho et al. (29) also reported significant levels of inbreeding in six horse breeds, including the QM breed, using neutral markers (microsatellite DNA), leading to deviations from the Hardy-Weinberg equilibrium.
The average production of embryos after insemination is closely related to an interfollicular biochemical complex that activates inhibin, which controls the synthesis and release of FSH. On the other hand, Estradiol decreases the expression of eFSHR and LHR in the follicles. This leads to an increase in IGF-1 in the fluids of the dominant follicle, altering the blood flow in the other follicles and ultimately releasing only one follicle (30). This explanation justifies donors' low rate of embryo production during the 2021 breeding season, which was not significantly different between haplotypes.
Regarding identifying more than 70 segments as potential binding sites for factors that regulate gene expression, SNP1 stands out with the presence of the transcription factor SP1 (Specific Protein 1). SP1 regulates numerous genes by binding to GT or GC boxes in promoters, playing a role in cell differentiation and embryonic development (31). TFAP-2alpha, another factor identified, binds to GC-rich regulatory regions in the 5' regulatory region and is directly associated with embryonic development in various species when interacting with other genes (32). The GR (Glucocorticoid Receptor) binding site was found in SNP2, and its absence is directly associated with glucocorticoid resistance (33).
Conclusion
The regulatory region of the eFSHR gene exhibits significant polymorphic variations that are suitable for population analysis. These variations may play a role in regulating gene expression in primordial gametic cells, making the eFSHR gene a potential candidate for selection processes assisted by molecular markers targeting traits related to follicular formation. However, it should be noted that the number of maturing follicles is not directly associated with follicular release or the production of embryos in horses. Nevertheless, these findings can be utilized in studies that evaluate the follicular wave in mares.
Acknowledgment
We thank the Federal Rural University of Amazon for providing all the laboratory facilities necessary to execute this work.