Introduction
Sheep production is one of the crucial livestock sectors worldwide (1,2). In Egypt, sheep are the most common small ruminants, with an estimated number of about 2.972 million heads raised for meat, milk, and wool. Most sheep breeds are indigenous, e.g., Rahmani, Ossimi, and Barki (3,4). Gastrointestinal nematodes (GINs) are actual threats to the health and productivity of livestock in temperate and tropical regions all over the world (5,6). Haemonchosis is among sheep's most serious parasitic diseases (7,8), caused mainly by Haemonchus contortus living in the abomasum. Being the most fertile GIN, it can lay up to 10,000 eggs per worm per day, which pass through feces and increase the likelihood of a widespread infection on pasture. In addition, it can suck the blood at a rate of 0.03 millilitres per worm per day, which results in anemia and protein loss (9,10). Furthermore, its migration and feeding activity results in significant inflammatory alterations to the stomach tissue, which may lower the infected animals' capability to digest food and absorb nitrogen, organic matter, and energy in the diseased animals (11-13). Therefore, the infection among sheep caused substantial financial losses due to the increased susceptibility of animals to other infections, morbidities, cost of treatment, and high mortalities (14). Haemonchus placei is more adapted to cattle, but infections with species H. contortus and H. placei may occasionally occur in sheep and goats (15). Haemonchus contortus resistance to most anthelmintic medications is rapidly growing, causing significant health and economic problems (16). In addition, it is recognized by a high rate of gene flow across populations, conferring an opportunity to disseminate genes and awarding resistance to anthelmintics (17). Excessive dependence on synthetic drugs and improper dosing are among the main reasons for the emergence of anthelmintic resistance to all classes of anti-parasitic chemotherapeutics in ruminants (16). Multiple studies have recognized the negative effect of anthelmintic resistance on farming animals all over the world: in Europe (18), Africa (19), Asia (20), and the Americas (21,22). So, periodical assessment of the severity of the infection is essential due to the continuous variability of environmental and geographical parameters, population growth, and living conditions that change a parasite population's genetic makeup (23). Studying epidemiological patterns of H. contortus has been globally reported by Yin et al. (17) in China; Mannan et al. (24) in Bangladesh; Ndosi et al. (25) in Tanzania; Das et al. (26) in India; and Regassa et al. (6) in Ethiopia. Successful mass screening of parasitic infections among populations mostly relies upon coprological examination, postmortem investigation, and serological techniques using ELISA (27,28). However, they might have low sensitivity and cannot differentiate the circulating species/genotypes (29). The reliable identification of the helminths at the species level, the study of the phylogenetic relationships between the species, the understanding of their epizootiology, and the tracing of origins are considered the cornerstones for maintaining treatment efficacy and establishing efficient, eco-friendly alternative treatment, preventive, and control programs (30,31). Therefore, molecular tools were developed to detect the species specificity and intra-specific differences related to the geographical distribution (25). Mitochondrial DNA (mtDNA) has a higher substitution rate than nuclear DNA, so it is suitable for detecting differences between closely related ones (32). The internal transcribed spacer is the most conserved region, exhibiting high interspecific sequence divergence and intraspecific sequence homogeneity. Haemonchus species have two internal transcribed spacers, ITS-1 and ITS-2, known as the best markers for genetic studies at the species level (26).
Controlling haemonchosis is necessary for recouping losses since it adversely affects the small ruminant industry worldwide, including Egypt. To implement reliable parasite control, it is necessary to update a thorough understanding of the current epidemiological status impacting the spreading of disease. Despite numerous studies having been conducted on H. contortus infection in Egypt, there is a paucity of available data about its prevalence, molecular screening, and phylogeny in Cairo and Giza governorates. Therefore, this study aims to provide reliable epidemiological data regarding the current status of ovine haemonchosis, which may be instrumental in managing anthelmintic resistance, halting the spread of infection, and developing effective preventive and control strategies.
Material and methods
Ethical approval
Ethical permission for the use of animals was approved by institutional guidelines of the National Research Centre’s Animal Research Committee (13050425-1).
Studying area
The study was conducted in Giza governorate (29° 16′ N 29° 40′E/29.26° N 29.67°E), with geographical coordinates, latitude, and longitude of 30.0130557 and 31.2088526, and Cairo governorate (30°2′40″N 31°14′9″E), with geographical coordinates, latitude, and longitude of 30.0444196 and 31.2357116, in Egypt.
Study design, animals and sampling
Thorough clinical inspection was fulfilled; sheep with signs of weakness, weight loss, inappetence, anemia, mucous membranes, rough coat, soft feces, or diarrhea were selected. The study was conducted on two groups of sheep; the first group included live sheep that were not exposed to approved treatment and were reared by small-scale smallholder shepherds, and the second one included sheep slaughtered at the abattoirs that were subjected to previous treatment using commercial local anthelmintics before slaughtering in their rearing farms. Data collected from the owners of slaughtered animals had reported the use of albendazole 1 mL 2.5%/ 5 kg BWt as a single dose for parasitic infection during rearing at 6- 6-month intervals. At the same time, there was a misuse of anti-parasitic chemotherapeutics among the live sheep in the form of inadequate dosing and a total absence of veterinary care in some cases. Moreover, sheep were housed in groups in well-ventilated, small farms. Fresh, clean tap water was available at all times. Sheep were fed on roughage stored either as hay or low-moisture, green, vegetative chopped food and forage. A mass screening of haemonchosis using ELISA was carried out by collecting three hundred blood samples from the live sheep. A total of nine hundred thirty-two sheep were sampled at Elbasatine, Nahia, and Elmonieb abattoirs to study risk factors associated with high incidence and abomasa histopathological alterations during the period extended from March 2023 to February 2024. The abattoirs were visited monthly for Haemonchus detection in the abomasa and collection of positive blood samples for Haemonchus (33). Before slaughtering, age, breed, sex, season, and climate were recorded at sampling time. The climate was divided according to the medium temperature of the different seasons of the study areas; the hot season includes Summer and Spring with an average temperature of about 93 F / 34 C, while the cooler one includes winter and autumn with an average temperature of about 77 F / 25. The number of inspected sheep could be categorized according to each criterion as follows: 582 and 350 for more than 2 years and less than 2 years 500, 300, and 132 for Barki, Ossimi, and Sudanese breeds, 207 and 725 for female and male, 280, 240, 257, and 155 during Spring, Summer, Autumn, and Winter, and 520 and 412 in hot and cold climates, respectively.
Adult worms’ recovery
Each abomasum was collected and delivered in a separate labelled plastic container in a cool box to the laboratory in the Parasitology and Animal Diseases Department, Veterinary Research Institute, National Research Centre. Abomas were opened from the greater curvature with careful removal of the ingesta. The worms of Hamonchus spp. were recovered from abomasa (33) and thoroughly washed using 0.15 M phosphate-buffered saline (PBS) at pH 7.2 and then kept at -20ºC in PBS until used for the preparation of crude antigen (34). The male worms were collected separately and kept in 70% ethyl alcohol at -20ºC until DNA extraction was performed (25).
Histopathological inspection
After the infected abomasa was inspected, 97 heavily infected abomasa out of 346 were handled. Tissue samples were taken from the fundic region of the abomasum, fixed in 10% neutral buffered formalin, dehydrated, cleared, and embedded in paraffin wax. Tissue sections at 4 µm were stained with H&E staining and examined microscopically for histopathological changes (35).
Sera preparation
The serum samples were collected after centrifugation, then aliquoted and stored at −20 °C till being utilized. Blood samples from one-day-old newborn lambs were collected and used to prepare negative sera. Positive sera for Haemonchus were prepared from the blood samples collected from the sheep that were confirmed to be infected after slaughtering at the abattoir.
Antigen
Crude somatic antigen was prepared from collected Haemonchus worms according to the procedure of Hassan et al. (36). The supernatant soluble antigen extract was assembled, and the protein content was measured by Peterson (37). The antigen was aliquoted and kept at -20 °C till further use. The antigen was aliquoted and kept at -20 °C till further use.
Indirect-Enzyme-linked immunosorbent assay
Indirect ELISA was utilized to assign antibodies against haemonchosis in sheep. Before use, checkerboard titrations assigned the working dilutions of the conjugate, antigen, and test sera. ELISA was performed according to Hassan et al. (34). The cutoff point of optical density values was assigned, as reported by Hegazi et al. (38).
DNA extraction and amplification
The genomic DNA extraction was carried out for the individual male Haemonchus adult worms according to the instruction manual of the GeneJET Purification Kit (Thermo Fisher Scientific®). Each sample was eluted in 40 μL of Tris-EDTA (TE) elution buffer. The total DNA concentration and the purity were measured spectrophotometrically, and the DNA was preserved at -20 °C for further processing. For differentiation between H. contortus and H. placei, a set of species-specific primer pairs was used, including HpL BotuF and HpL BotuR for H. placei. While Hcon BotuF1 and Hcon BotuR2 were utilized for H. contortus detection, table 1 (39). For confirmatory characterization and phylogenetic analysis, different primers, including Haemonchus JB3 and Haemonchus JB4.5 (based on the mitochondrial cox-1 gene) and Haemonchus NC2 and Haemonchus NC5 (based on the ITS-2 gene), were used (Table 1) (25). The mixture for each reaction was 2x master mix buffer, 10 pmol from each sense and antisense primer specific for each reaction, 100 ng from the extracted DNA, and nuclease-free water to complete the reaction. PCR products were visualized by electrophoresis in stained 1.5% agarose gels.
Table (1) List of primers utilized in the current study
|
Parasite
|
Primer name
|
Sequences (5′- 3′)
|
Annealing (°C)
|
Size (bp)
|
Reference
|
|
H. placei
|
HpL BotuF
|
CCAGACCCGAGACTCGCC
|
58.5
|
459
|
(40)
|
|
HpL BotuR
|
CTGAAGGTAATGTCAAAATTTCT
|
|
H. contortus
|
Hcon BotuF1
|
TGTCGAACACGAAACTCGTC
|
59
|
260
|
(40)
|
|
Hcon BotuR2
|
TGTGTCTCTACCGCCCGAGT
|
|
COX1
|
Haemonchus JB3
|
TTTTTTGGGCATCCTGAGGTTTAT
|
55
|
317
|
(25)
|
|
Haemonchus JB4.5
|
TAAAGAAAGAACATAATGAAAATG
|
|
ITS2
|
Haemonchus NC2
|
TTA GTT TCT TTT CCT CCG CT
|
58
|
520
|
(25)
|
|
Haemonchus NC5
|
GTAGGTGAACCTGCGGAAGGATCATT
|
Sequencing and phylogenetic analysis
Samples of the amplified cox1 and ITS-2 genes were purified from the gel using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific®). The DNA was measured, and part was tested on gel while the rest was sent for sequencing. The obtained sequences were analyzed and aligned using the free online tool BioEdit 7.2 (https://bioedit.software.informer.com/7.2/). The free Blast tool of the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to detect regions similar to the biological sequences. The evolutionary history was done using the Maximum Likelihood method based on the Tamura Nei model (40). The phylogenetic analysis of the COX-1 gene involved 26 nucleotide sequences. At the same time, analysis of the ITS-2 gene involved 22 nucleotide sequences, including Babesia vogeli regions as an out-group. All positions containing gaps and missing data were removed. Evolutionary analyses were carried out using MEGA7 (41). The confidence level of the tree was assessed by bootstrapping using 1000 replicates.
V-Statistical analysis
The prevalence was presented as a percentage of the number of animals infected in the total number of animals examined. Data were summarized by descriptive statistics for the overall prevalence in sheep. A Chi-square test was utilized to investigate the monthly and seasonal infection rates. A Chi-square test was performed to assess the association of haemonchosis with age, sex, breed of tested sheep, and season and climate at the time of the sample collection. Variables were significant at p ≤ 0.05. ORs (odds ratios) were reported to compare risks. All statistics were analyzed, and graphs were plotted using GraphPad Prism version 6.0 (GraphPad Software, La Jolla, CA, USA).
Results
Prevalence of haemonchosis
Detection of circulating anti-Hamonchus IgG antibodies revealed that (210/300) 70% of the live sheep was seropositive (Figure 1).
Figure 1: Sero-prevalence of haemonchosis is detected by detecting circulating IgG antibodies in live sheep reared in Cairo and Giza Governorate, Egypt, using indirect ELISA. The cutoff value for seropositivity was 0.43.
The prevalence of haemonchosis was determined by inspecting the abomasa of the slaughtered sheep over the period extending from March 2023 to February 2024 at the Elbasatine, Nahia, and Elmonieb abattoirs, which was (346/932) 37.1%. Monthly prevalence of Haemonchus spp. revealed that sheep were highly infected in October at (45/77) 58.4%, while the infection rate was the lowest in February at (8/50) 16% (χ² = 50.606 and p-value < 0.001), as demonstrated in figure 2. Moreover, the prevalence was the highest in autumn (135/257), 52.2% (χ2=9.342 and P< 0.0001), while Spring recorded the lowest infectivity (81/280), 28.9% (Table 2). The prevalence was prominent in the colder climate, 43.9% (χ2=1.895 and P-value < 0.0001), in contrast to the hotter one, 31.7%.
The age of animals played a significant role in the infection of haemonchosis in the sheep. The results showed that the infection rate of young sheep (less than 2 years) was 49.4%, which was more than the older ones (more than 2 years) at 29.7% (χ2=4.569 and PHaemonchus spp., while Barki was the least affected. The association between haemonchosis infection and risk factors related to age, sex, season, and sheep breed is illustrated in table 2 and figure 3. The odds ratio and 95% CI were calculated. It was found that young age (OR: 1.4559-95% CI: 1.1398 to 1.8596), autumn season (OR: 2.4334-95% CI: 1.8136 to 3.2650), colder climate (OR: 1.7782-95% CI: 1.3575 to 2.3292), and imported Sudanese breed (OR: 1.7619-95% CI: 1.2338 to 2.5160) are considered risk factors for infection of haemonchosis.
Figure 2: Monthly prevalence of Haemonchus spp. among sheep through abomasal inspection.
Table 2: The strength of the association between studied risk factors and infection status according to abomasal examination.
|
Variable
|
|
Total/ infected
|
Prevalence %
|
χ 2
|
OR
|
(95%CI)
|
p- Value
|
|
Age
|
<2 years
|
350/173
|
49.4
|
4.569
|
1.4559
|
1.1398 to 1.8596
|
0.0026
|
|
>2 years
|
582/173
|
29.7
|
0.5728
|
0.4328 to 0.7581
|
0.0001
|
|
Gender
|
Male
|
725/268
|
36.9
|
0.013
|
0.9699
|
0.7050 to 1.3343
|
0.8509
|
|
Female
|
207/78
|
37.6
|
1.0427
|
0.7577 to 1.4349
|
0.7972
|
|
Climate
|
Hot
|
520/165
|
31.7
|
1.895
|
0.5624
|
0.4293 to 0.7366
|
P < 0.0001
|
|
Cold
|
412/181
|
43.9
|
1.7782
|
1.3575 to 2.3292
|
P < 0.0001
|
|
Breed
|
Barki
|
500/149
|
29.8
|
10.093
|
1.1771
|
0.8763 to 1.5811
|
0.2788
|
|
Ossimi
|
300/119
|
39.6
|
2.0966
|
1.5449 to 2.8453
|
P < 0.0001
|
|
Sudanese
|
132/78
|
59
|
1.7619
|
1.2338 to 2.5160
|
0.0018
|
|
Season
|
Spring
|
280/81
|
28.9
|
9.342
|
0.5944
|
0.4395 to 0.8039
|
0.0007
|
|
Summer
|
240/84
|
35
|
0.8837
|
0.6504 to 1.2007
|
0.4293
|
|
Autumn
|
257/135
|
52.2
|
2.4334
|
1.8136 to 3.2650
|
P < 0.0001
|
|
Winter
|
155/46
|
29.6
|
0.6710
|
0.4618 to 0.9750
|
0.0364
|
Figure 3: Prevalence rates and adjusted odds ratios (OR) with 95% confidence intervals (CIs) for infection with haemonchosis.
Abomasal macroscopic findings
Figure 4 illustrates the macroscopic examination of the infected abomasa. The examination revealed the presence of small blood clots and mucus in the ingested food. Haemonchus worms were found to be partially embedded in the mucosal membrane and partially submerged in the ingested food. The mucosal membrane showed edema and scattered white focal nodules. It was noted that mucosal folds thickened in the presence of petechial hemorrhages.
Figure 4: A. Abomasa of heavily infected sheep with haemonchosis contained hundreds of Haemonchus worms mixed with food ingesta. B. Collected Haemonchus worms. C. Abomasa showed a hemorrhagic, red, spotty mucous membrane due to hamonchosis.
Histopathological alterations
The microscopical examination of the fundus part of the abomasum is illustrated in figure 5. The examination revealed severe necrosis and desquamation of mucosal surface epithelium lining into the lumen associated with necrosis of gastric pits and neck (5-A). The epithelium lining of the abomasal glands showed degenerative and necrotic changes. In some areas, the destructed and atrophied glands were replaced by masses of inflammatory cells. Moreover, there was diffuse and massive multifocal inflammatory cell infiltration associated with interstitial edema in the lamina propria of abomasal mucosa, mainly in the deeper part, and the infiltrates were predominantly composed of mononuclear cells (lymphocytes, plasma cells, and macrophages) and eosinophils. In some cases, marked thickening of abomasal mucosa due to hyperplasia of dilated gastric glands was seen. In addition, mild to moderate mucosal and submucosal edema was observed. The blood vessels and lymphatics appeared relatively dilated.
Figure 5: Abomasum infected with H. contortus (A): showing severe necrosis and sloughing of surface epithelium lining and gastric pits and neck into the lumen, in addition to degenerative and necrotic changes of the epithelium lining of gastric glands (H&E, X100). (B): showing mucous degenerative and necrotic changes of epithelium lining of gastric glands at the neck and body parts, moderate inflammatory cell infiltration. Note parietal cells with profoundly eosinophilic cytoplasm and pyknotic nuclei (black arrows) and vacuolation of mucous cells (yellow arrows) (H&E, X200). (C): showing degenerative and necrotic changes of epithelium lining of gastric glands (yellow arrows) at the base part associated with heavy peri-glandular aggregations of mononuclear inflammatory cells and eosinophils in the deeper part of the lamina propria of the mucosa, with replacement of necrotic gastric glands by inflammatory cells (H&E, X200). (D): showing intensive focal aggregations of mononuclear inflammatory cells and eosinophils (yellow arrows), as well as interstitial edema in between the degenerated gastric glands and deeper part of the lamina propria of the mucosa ((H&E, X100). (E): showing massive diffuse infiltration of mononuclear inflammatory cells and eosinophils in the deeper part of the lamina propria of the mucosa, interstitial edema, and replacement of degenerated and atrophied gastric glands (yellow arrows) by masses of inflammatory cells (H&E, X100). (F): showing prominent hyperplasia of gastric glands (star), necrosis, and desquamation of surface epithelium lining into the lumen (yellow arrows). (H&E, X40).
Molecular identification of Haemonchus spp.
The molecular identification of the obtained worms using 2 different sets of specific primers for H. contortus and H. placei for each DNA sample extract revealed that all the adult males were classified under the H. contortus species, and no H. placei worms were identified.
Phylogenetic analysis
The obtained H. contortus was identified by partially amplifying the COX-1 gene and the ITS-2 region. The obtained sequences of the COX-1 gene were uploaded to the Gene Bank with the accession numbers (PP590303, PP590304, PP590305, PP590306), while those of the ITS region were (PP590638, PP590639, PP590640, and PP590641). Phylogenetic analysis based on the COX-1 gene revealed that the locally obtained isolates were related to each other and classified under the same clade or cluster of the H. contortus species. The nucleotide identities between the H. contortus species were revealed by a percentage composition of 94.85–99.37%. The obtained isolates were closely related to those previously detected in Egypt (AB682706. and AB682707.1) and those recently isolated in Nigeria during 2021 (OL435361.1 and OL435444.1), as shown in figure 6. On the same side, analysis based on the ITS-2 confirmed the previously obtained results that our detected isolates were H. contortus, as the identity percentage with the previously recorded ones was 98.29-99.78%. The obtained isolates were closely related to those obtained from a small ruminant in Tanzania during 2021 (OK181226.1) and those obtained from a giraffe in Florida, USA (EU086389.1), as illustrated in figure 7.
Figure 6: The phylogenetic analysis of the COX-1 gene created by MEGA 7 software. The black circles indicate the sequences obtained in this study.
Figure 7: The phylogenetic analysis of the ITS-2 gene created by MEGA 7 software. The black triangles indicate the sequences obtained in the current study.
Discussion
Haemonchosis is one of the threats to sheep health and production worldwide (16). The study revealed that H. contortus infection is widespread among sheep across Egypt, particularly in Giza and Cairo governorates. The results showed a high seroprevalence of haemonchosis 70% among the living sheep reared by the shepherds. These results are similar to those obtained by Mir et al. (42) in India, who found that 72.22% of sheep were seropositive using crude somatic antigens. Moreover, Hassan et al. (43) in Beni Suef, Egypt, revealed 64.48% seropositivity for H. contortus using larval antigen. While Gowda (27) in India, it was observed that 58.66% of the migratory sheep were seropositive for H. contortus using somatic antigen. These variations might be correlated to the type of antigen and its preparation method, the immunity level of animals, and the number of screened sheep. Moreover, the results disclosed that the prevalence of haemonchosis was 37.1% (346/932) through abomasal examination of the slaughtered sheep at the abattoirs. Variable incidences of Haemonchus infection were recorded at slaughterhouses by Abdo et al. (44) in Ethiopia 69.6%, Mannan et al. (24) in Bangladesh 51.3%, and Regassa et al. (6) in Ethiopia 34.40%. Geographical differences, management care, and prevention and control measures between countries might impact the prevalence of diseases among animals. The current study showed a variable incidence of haemonchosis in both live sheep that were not subject to adequate authorized treatments or care and the slaughtered sheep that had been provided with treatment regimes. This might indicate the danger of the misuse of anthelmintics and the possibility of the emergence of anthelmintic resistance among worm populations and decreasing drug efficacy (45,46).
It is evident that the infection of haemonchosis significantly increased during the autumn season 52.2%, where it reached 58.4% in October. This was reflected in the infectivity during the colder climate in Cairo and Giza Governorates, where the infection reached the highest level compared to the summer season (p-value <0.001). These results might coincide with those Bentounsi and Cabaret (47) reported, who mentioned that mild or cool semiarid climatic conditions are the most favourable for strongyles infection. Similarly, Mushonga et al. (48) noticed the high prevalence of H. contortus among sheep in October. Meanwhile, Brik et al. (49) found that the highest infection rate was during Spring (36.36%), followed by autumn (32.37%), while a low rate of 2.7% was observed in the summer. It was stated that the prevalence of different nematode species was related to the change in climate at different ecologies (50-52).
The current findings verified that an animal's age was a significant factor in the spread of sheep haemonchosis. In contrast to the older sheep (>2 years), the infectivity of the younger sheep (<2 years) was noteworthy, reaching 49.4 and 29.7%, respectively. These findings concurred with those of Dagnachew et al. (53), Brik et al. (49), and Qamar et al. (54). That could be because younger sheep have less immunity than older sheep. In addition, it is possible that young sheep being fed on grasslands, particularly in their first year, exposed them to infections (55-58).
The current findings made it clear that the animals' sex had no discernible impact on the infection's ability to spread among sheep. This was consistent with the data obtained by Qamar et al. (54) and Razzaq et al. (59). The findings were in conflict with those of Fentahun and Luke (60), who showed a prevalence of 77.1% in males and 80.9% in females, as well as those of Brik et al. (49), who claimed that females are more prone to parasitism. The hormone variations between animals may impact an animal's susceptibility to parasites. Males are more vulnerable to infection than females because of androgen hormones. In contrast, females may be more resistant because of the effects of estrogen, according to research by Urquhart et al. (61). In contrast, Raza et al. (62) stated a higher prevalence in females due to lower resistance during reproductive events and unbalanced feed intake.
It was found that the occurrence of haemonchosis is significantly influenced by the breed of sheep. In this instance, the infection rates for Barki, Ossimi, and imported Sudanese sheep are 29.85, 39.6, and 59%, respectively. According to McManus et al. (63), a sheep's breed may impact its susceptibility to Haemonchus infection. This could be caused by genetic variables and the host's tolerance to infection in addition to the variety of Haemonchus spp. in the various breeds and nations.
Migration and development of Haemonchus in the lining mucosa of the abomasa and its feeding habits can cause severe histopathological changes. These damages enhanced the infiltration of immune cells into abomasal lining tissue (12). The present findings disclosed great damage to the infected abomasal mucosa, including diffuse and massive multifocal inflammatory cell infiltration associated with interstitial edema in the lamina propria of abomasal mucosa, mainly in the deeper part, and the infiltrates were predominantly composed of mononuclear cells (lymphocytes, plasma cells, and macrophages) and eosinophils; hyperplasia of dilated gastric glands; and dilatation of blood vessels and lymphatics. Besides, degenerative and necrotic changes in gastric glands were more notable. Similarly, Simpson (64) and Stear et al. (65) found that haemonchosis induced superficial damage to epithelial cells, hypertrophy of the mucosa, and edema, followed by the formation of lymphoid aggregates and the infiltration of inflammatory cells in response to tissue damage. This damage might lead to destructive dystrophy of the gastric mucosa of infected sheep, causing severe health illness, including malfunction of the digestive system, impaired growth, and weight loss.
While electron microscopy is a benchmark technique for confirming the worm, and parasitological examination is the golden standard for identifying Haemonchus species, both procedures are time-consuming, labour-intensive, and occasionally insensitive (66). Nucleic acid amplification and sequencing are significantly more effective and valuable tools for identifying almost all infectious disease pathogens of veterinary concern (67-70).
The PCR technique can detect and discriminate H. contortus infections from those caused by other trichostrongylids (71). The used primer set in this study was characterized by high sensitivity and specificity to differentiate between H. contortus and placei (40). The obtained results confirmed the presence of H. contortus only. The same results were obtained in different studies, as this type was predominant in small ruminants, while the H. placei type was the most common in cattle (72). At the same time, Gareh et al. (15) exhibited the existence of H. placei and H. longistipes in goats in Assiut Governorate, Upper Egypt, Egypt. It is important to note the presence of a clear correlation between the grazing pasture with the management system and the infection type with the Hemonchus spp. as previously recorded (30).
For more confirmation of the obtained results, different sets of primers based on the ITS2, and COX-1 genes were used to partially amplify the corresponding genes. The alignment and the phylogenetic analysis of the obtained sequences confirmed the obtained H. contortus species. The homology between the obtained isolates was above 99.5%. Studies on the population genetics of H. contortus have revealed that this species has minimal genetic differentiation within continuous geographical regions and substantial population variance within populations, which is probably due to high gene flow caused by host movements (73,74). Nonetheless, evidence for the global gene flow has been reported, and these are related to the parasite's limited capacity for dissemination and the host's limited ability to move across continents (23). Molecular taxonomy techniques have been utilized for polymorphism research in recent years, and accordingly, the H. contortus and H. placei were more closely related (75). In a comparative analysis of the second internal transcribed spacer (ITS2) sites in H. contortus and H. placei, Stevenson et al. (76) found just three variations in the ITS2 nucleotide sequences. To summarize, the ITS region is appropriate for molecular diagnostic purposes of Haemonchus species and across a diverse range of trichostrongylid nematodes (77).
Nematodes with direct life cycles and high infection rates, such as Haemonchus, combine to produce a huge effective population size and a wide genetic variety (78). The genetic diversity parameters between Haemonchus species may be attributable to variances in their prolificacy, prepatent period, host predominance, and evolutionary rate (79). Because the genome of mitochondrial DNA substitutes more frequently than that of nuclear DNA, variations between closely related individual parasites can be reconciled (80-82). Variations found in the ND4 gene (17,23,71,80,81) and COX-1 gene (72,82) were the basis for most genetic diversity studies for Haemonchus populations previously reported from different countries. The current investigations indicated a high rate of gene flow among Haemonchus parasites infecting livestock in Egypt with 100% homology between COX-1 sequences and clustering of haplotypes coming from the specific host. The results provided agreed with those of Brasil et al. (83), who found that populations of Haemonchus spp. had substantial rates of gene flow among Brazilian sheep. The demographic structure was further clarified by comparing the COX-1 haplotypes of Haemonchus isolates from Egypt with those from other countries. The Haemonchus isolates from Egypt (AB682706.1 and AB682707.1) and Nigeria (OL435361.1 and OL435444.1) had the highest level of identity with our isolates. The observed clustering pattern could be supported by the possibility of host movement across African regions or evolutionarily comparable ancestors in both countries.
Conclusion
The study concluded that H. contortus infection is prevalent among sheep across Egypt, particularly in Cairo and Giza Governorate. The high incidence of H. contortus is significantly associated with age, breed of sheep, season, and climate. The disease is considered a life threat, causing severe destructive damage and necrosis of the lining abomasal mucosa. Phylogenetic analysis reveals a close association with Nigeria, Tanzania, and USA H. contortus isolates. Strict preventive and control measures during importing sheep breeds and accurate use of anthelmintic treatment should be considered to combat the disease.
Acknowledgments
The authors duly acknowledge the precious support offered by the National Research Centre.
Conflict of interest
The authors declare no competing interests.