Introduction
Infectious bursal disease (IBD) is a contagious disease that causes inflammation in the immunity organs, such as the spleen and bursa of Fabricius, and causes serious losses in the chicken industry, particularly in young birds (1,2). Due to the pathological and morphological changes in the bursa, this disease was later dubbed Infectious bursal disease (IBD); within 3-5 weeks of the rapid development of the bursa, the clinical form of the disease improves in infected birds, and the IBDV develops severely. The subclinical form occurs at less than three weeks of age, and the development of immunity in the acute and sub-clinical forms prevents adequate immune response to vaccinations and increases the possibility of secondary infection (3,4). Additionally, in terms of hygiene status, active and passive vaccination plays a major role in preventing bursal diseases (5). like mammals, the liver of birds is implicated in an array of homeostatic and metabolic functions and is deemed a biochemical factory accountable for most metabolism, synthesis, detoxification, and excretion processes; it plays a significant role in food digestion, metabolism production regulation, storage of lipids, and release of both proteins and carbohydrates (6). The liver of avian can be affected by diverse etiologic agents and conditions. Beyond the biological causes, some degenerative changes were detected, such as glycogenic, hydropic, fatty changes, and metabolic disorders. Such depositions are seen, for instance, urate, amyloidosis, and hemosiderosis (7-9), fatty liver hemorrhagic syndrome (10), circulatory disturbance (11), and neoplasms such as Cholangioma, hepatocellular adenoma, and cholangiocarcinoma were recorded as well (12,13). Selenium is a nutrient that improves the productive performance in poultry production (14). It actively participates in diverse physiological functions, including antioxidant defense mechanisms, which are integrated into selenocysteine in combination with seleno-enzymes like glutathione peroxidase. In these regards, Se is added to the food of animals to improve their defense mechanism as antioxidants (15). Selenium's biological role is performed via glutathione peroxidase enzyme (GSH-Px). This enzyme, which, in its effective sites, implicates selenium together with superoxide dismutase, vitamin E, and catalase, participates in the cell membrane defense mechanism from damage of peroxidase (16). Nanomaterials are utilized in cellular, molecular biology, mineral nutrition biotechnology, and reproductive in both human and animal models (17-20). Nanomaterial is widely used in food and agricultural systems (21-23). The application of these materials in animal husbandry is very important (24,25). Amongst these materials, nano-Se has been attracted in the poultry industry due to its boosting bioavailability, catalytic effectiveness (26-28), capacity of absorption, and reducing toxic effects in comparison to the traditional sources of selenite. A few agents elaborate as antioxidant elements, the trace agents that are indirectly included in the demolition of the free radicals (17,18). A few elements, like selenium, zinc, and copper, are the basic deductive factors for the antioxidant enzymes, such as glutathione peroxidase and superoxide dismutase (29,30). To counteract reactive oxygen species (ROS) effects, live organisms have developed a complex 3-line defense mechanism of antioxidants. The first line is the more efficient and includes antioxidant enzymes like catalase, glutathione, and superoxide dismutase (31-33).
The aim of this work is to detect the histopathological changes of vaccines and Se-NP on the bursa of Fabricius diameter and the molecular analysis of GPX-1 in the broiler liver.
Material and methods
Ethical approval
The Ethical approval was agreed upon at the College of Veterinary Medicine-University of Mosul following the Animal Care Ethics Committee approval; the experimental protocol was used, numbered VET.2024-087, dated 15/11/2024.
Experimental design
Ninety-six one-day-old Ross 308 broilers were supplied with a source of heat, bedding, and ad libitum of food and water daily. According to their age, the birds were fed on pellets. They were divided randomly as follows: E1 was a control group and was supplemented with distilled water, E2 was vaccinated with 65PV-1 live intermediate strain of IBD at two-time points (12 and 20 days old) using the eye drop and the dose of vaccine used to follow the instructions of the manufacture and E3 were supplemented with a mix of Se-NPs and vaccinated with 65PV-1 live intermediate strain of IBD at two-time points (12 and 20 days old). E4 was supplemented with Se-NPs at 0.3mg/kg of body weight.
Birds were sacrificed at 19 26-day-olds, and on the last day of the experiment at 42 days, ten birds were sacrificed from each group: Liver and bursa of Fabricius were collected for conventional polymerase chain reaction (RT-PCR) and for micromorphological study, respectively. Gross morphology was done to detect any obvious macroscopic findings, particularly in the bursa of Fabricius. For histomorphometry, the collected tissue samples were preserved in 10% of formalin. Then, the samples were further treated and embedded in paraffin wax, sliced in 4-5 µm, and stained with routine stain (34). Follicles of the bursa, cortex, and medulla were measured under light microscope (35).
Collection and processing of liver tissue
Representative liver tissue samples, approximately 1-2 cm in size, were collected and immediately fixed in 10% neutral buffered formalin for proper preservation. The fixed tissues were then dehydrated through a graded series of alcohol concentrations and cleared using xylene. Subsequently, the samples were embedded in paraffin wax. Paraffin-embedded liver sections were cut into thin slices of 4-5 µm thickness using a rotary microtome. These sections were then mounted on glass slides and stained routinely with hematoxylin and eosin to assess the histological architecture (34).
RNA extraction from liver tissue
RNA was extracted from frozen liver tissue 50-100 mg following the protocol provided by Addbio (Korea). The sample was placed in a 1.5 ml microcentrifuge tube, to which 400 µl of lysis buffer, 4 µl of β-mercaptoethanol, and 20 µl of proteinase K solution (20 mg/ml) were added. Homogenization was performed using appropriate equipment, followed by vortexing to ensure complete mixing. The homogenized sample was incubated at 26ºC for 10 minutes and then centrifuged at 13,000 rpm for 3 minutes. The supernatant was carefully transferred to a spin column (white ring) seated in a 2.0 ml collection tube and centrifuged at 13,000 rpm for 30 seconds. The flow-through was retained.
To the collected flow-through, 400 µl of binding buffer was added and mixed by pulse vortexing for 10 seconds. The mixture was then centrifuged at 13,000 rpm for 1 minute. Approximately 500-600 µl of the resulting supernatant was transferred to a fresh microcentrifuge tube. An equal volume of binding buffer and 200 µl of absolute ethanol were added to this tube and mixed thoroughly. Subsequently, 600 µl of this lysate was loaded onto a second spin column (green ring) and placed in a 2.0 ml collection tube, ensuring the rim was kept dry. The sample was centrifuged for 10 seconds at 13,000 rpm. This step was repeated with the remaining lysate to ensure full processing.
Following binding, the column was washed with 500 µl of Washing Solution 1 and centrifuged for 10 seconds. After discarding the flow-through, the spin column was reassembled with a fresh collection tube and left at room temperature 20-30ºC) for 15 minutes. A second wash with 500 µl of Washing Solution 1 followed by centrifugation at 13,000 rpm for 1 minute was performed. Next, 700 µl of Washing Solution 2 was added and centrifuged under the same conditions. To eliminate residual ethanol, an additional centrifugation was carried out for 1 minute. Finally, the spin column was transferred to a clean 1.5 ml tube, and 50 µl of elution solution was applied. After allowing the solution to sit for at least one minute, RNA was eluted by centrifugation at 13,000 rpm for 1 minute and stored at -20ºC.
Conventional PCR for GPX1 gene detection
Complementary DNA (cDNA) synthesis was conducted using the AddScript cDNA synthesis kit (Addbio, Korea), which includes all necessary reagents for first-strand synthesis. The 20 µl reaction mixture contained 10 µl of the AddScript cDNA Master Mix, 5 µl of total RNA, 1 µl of oligo dT20 primers (10× random hexamer), and 4 µl of nuclease-free water. The reverse transcription was performed using the MiniAmp Plus™ Thermocycler (USA) under the following thermal profile: priming at 25ºC for 10 minutes, reverse transcription at 50ºC for 60 minutes, and enzyme inactivation at 80ºC for 5 minutes. The resulting cDNA was then subjected to PCR amplification using AddStart Taq DNA Polymerase (Addbio, Korea). Specific primers targeting the Glutathione Peroxidase 1 (GPX1) gene were used: forward primer 5′-CGGCTTCAAACCCAACTTCA-3′ and reverse primer 5′-AAGTTCCAGGAGACGTCGTT-3′, all synthesized by Macrogen (Korea). The PCR mixture (20 µl) consisted of 10 µl of the polymerase mix, 0.5 µl of each primer, 5 µl of cDNA template, and 4 µl of nuclease-free water. PCR was carried out for 40 cycles under these conditions: initial denaturation at 95ºC for 10 minutes, denaturation at 95ºC for 10 seconds, annealing at 61ºC for 10 seconds, and extension at 72ºC for 30 seconds, followed by a final extension at 72ºC for 7 minutes. Amplicons were analyzed via electrophoresis on a 1.5% agarose gel stained with gel-safe dye using equipment from Cleaver Scientific (UK). The target product size for GPX1 was 183 base pairs.
Gene expression analysis of GPX1 using qRT-PCR
Quantification of GPX1 gene expression in liver tissue was performed using the One RT-PCR SYBR Master Kit from Addbio (Korea), designed for both reverse transcription and real-time PCR in a single-step reaction. Primer sequences used for GPX1 were identical to those used in conventional PCR and were also synthesized by Macrogen (Korea). The 20 µl reaction mix included 10 µl of the SYBR Master Mix, 0.5 µl of each primer, 2 µl of RNA template, and 7 µl of nuclease-free water. According to the manufacturer’s protocol, the reaction began with reverse transcription at 50ºC for 20 minutes, followed by denaturation at 95ºC for 10 minutes to both denature RNA hybrids and inactivate the reverse transcriptase. The real-time PCR was then conducted for 40 cycles using the following settings: denaturation at 95ºC for 15 seconds and annealing/extension at 61ºC for 60 seconds. Amplification and fluorescence detection were performed on the StepOnePlus™ Real-Time PCR system (USA).
Primers design
On the NCBI gene bank, we designed two sets of primers with 20 nucleotides for each primer we use, in which the GPX1 F: CGGCTTCAAACCCAACTTCA, GPX1 R: AAGTTCCAGGAGACGTCGTT (the primers were set at the flank of exon 4 of the GPX-1 gene). The total length of the product is 183 nucleotides, as demonstrated in the gel image. These two primers were specifically chosen because they are part of the mRNA sequence for gene expression. Upon rechecking across the entire genome, no misalignments were observed in any position, except for GPX1 in Gallus gallus. The gel also confirms the absence of any false or mismatched bands.
Statistical test
Analysis of the research data was done using the Windows software package SPSS (20.0 version; SPSS, USA, IL, Chicago). The significant means values were at P<0.05. Variations amongst the groups were analyzed by one-way ANOVA and Duncan’s tests (36).
Results
Bursa of Fabricius diameter measurement
The results of the Bursa of Fabricius diameter at 19-day-old chicks (Table 1), the non-significant difference between the follicle length and width, cortex thickness, and Length of the medulla are shown between all four groups, and the microscopic morphology images showed non-significant variation changes at 19 days old (Figure 1).
Table 1: Bursa of Fabricius measurement at 19 days of age
|
Groups
|
Follicle length
|
Follicle width
|
Cortex thickness
|
Medulla length
|
|
E1 (control)
|
449±64.65a
|
235.67±51.47 a
|
81±17.58a
|
314.33±95.76a
|
|
E2 (Gumboro vaccinated)
|
324±73.14a
|
231±107.62 a
|
51.33±11.72a
|
201.33±74.19a
|
|
E3 (Mix)
|
442.33±116.38a
|
274.67±12.42 a
|
77.33±27.54a
|
347.67±100.83a
|
|
E4 (Se-NPs)
|
317.67±76.5a
|
245.33±55.22 a
|
67±12.77a
|
274±5.57a
|
The same letters within each column (vertically) represent no significant difference at a P value < 0.05
Figure 1: Bursa of Fabricius photomicrographs at 19 days old, A: E1 (Control), B: E2 (Gumboro vaccinated), C: E4 (Se-NPs), D: E3 (Mix), H&E,100nµ.
A significant increase in the length of follicle 690.67±142.84 and medulla length 484.67±149.54 was observed in the E4 (Se-NPs) group at 27 days of the experiment, and non-significant variation was observed between E2 (Gumboro vaccinated) and E3 (Mix) groups as well as the follicle Width and cortex thickness did not show any significant between all groups at the same period (Table 2), bursa of Fabricius morphometric revealed a significant increase in the follicle and medulla length in E4 (Se-NPs) group (Figure 2).
Table 2: Bursa of Fabricius measurement at 27 days of age
|
Groups
|
Follicle length
|
Follicle width
|
Cortex thickness
|
Medulla length
|
|
E1 (control)
|
531.67±89.95ab
|
350.67±41.65a
|
76±28.16a
|
349±49.57ab
|
|
E2(Gumboro vaccinated)
|
338.67±109.56b
|
244±54.01a
|
60±5.57a
|
306.33±51.6b
|
|
E3 (Mix)
|
371±116.99b
|
348±130.29a
|
73±16.37a
|
290.67±36.67b
|
|
E4 (Se-NPs)
|
690.67±142.84a
|
340±15.72a
|
94.33±17.9a
|
484.67±149.54a
|
Different letters within each column (vertically) represent significant differences at P value < 0.05
Figure 2: Bursa of Fabricius photomicrographs at 26 days old, A: E1 (Control), B: E2 (Gumboro vaccinated), C: E4 (Se-NPs), D: E3 (Mix), H&E,100nµ.
A significant increase in the length of the Follicle and medulla was observed in E3 (Mix) group at 42 days old, 546.33±47.06, and 430±45.03 and non-significant difference in the width of follicle and cortex thickness was observed between all groups and non-accounting difference in the medulla length between the E4 (Se-NPs) and E2 (Gumboro vaccinated) group 304.67±46.2 and 296±34.51 (Table 3). Morphometric revealed a significant increase in the follicle and medulla length in the fourth group (Figure 3).
Table 3: Bursa of Fabricius measurement at 42 days of age
|
Groups
|
Follicle length
|
Follicle width
|
Cortex thickness
|
Medulla length
|
|
E1 (control)
|
506±39.04ab
|
321±13.89a
|
81.67±20.74a
|
355±70.87ab
|
|
E2 (Gumboro vaccinated)
|
427.67±32.19c
|
271±112.09a
|
59±8.54a
|
296±34.51b
|
|
E3 (Mix)
|
546.33±47.06a
|
328.67±57.1a
|
70.33±5.13a
|
430±45.03a
|
|
E4 (Se-NPs)
|
546.33±47.06a
|
328.67±57.1a
|
70.33±5.13a
|
430±45.03a
|
Different letters within each column (vertically) represent significant differences at P value < 0.05
Figure 3: Bursa of Fabricius photomicrographs at 42 days old, A: E1 (Control), B: E2 (Gumboro vaccinated), C: E4 (Se-NPs), D: E3 (Mix), H&E, 100nµ.
Follicle length
The E4 (SE-NPs) group showed a lower percent value in the length of the follicle at 19 days old -29.25 compared to the control group; at 26 and 42 days old, the E2 (Gumboro vaccinated) group showed a lower percentage value in the follicle length, -36.3, and -15.48 respectively (Figure 4).
Figure 4: Percentage change compared to the control follicle length.
Follicle width
The follicle width percentage For the E3 (Mix) group showed a higher value in the follicle width in contrast to the control group at 19 days old at 16.55. However, the E2 (Gumboro vaccinated) group showed a higher change value at 26 and 42 days old, -30.42 and -15.58, respectively (Figure 5).
Figure 5: Percentage change compared to the control follicle width.
Cortex thickness
Figure 6 revealed a higher percentage change in the cortex thickness in the second group (E2) (Gumboro vaccinated), in contrast to the control group at 19 days old, which was -36.63 at 26 days old, the Se-NPs treated group (E4) showed a higher percentage value of 24.12, while the vaccinated group (E2) at 42 days old showed a lower cortex thickness percentage comparing to the control group -27.76.
Figure 6: Percentage change compared to the control Cortex thickness.
Medulla length
As depicted in figure 7, the medulla length percentage change in the Se-NPs group (E4) was higher at 19 and 26 days old, at 29.25 and 38.87, respectively. The result showed a higher percentage of the medulla length in the mixed group (E3) at 42 days old, which was 21.13.
Figure 7: Percentage change compared to the control medulla length.
Detection of Se-NPs and Gumboro vaccine effects by RT-PCR
Out of 24 chicken liver samples tested with RT-PCR, figure 8 represents the product size we have done as per step to detect the gene expression of GPX-1; each number represents a different sample.
Figure 8: Gel electrophoresis of Glutathione Peroxidase 1 product with a molecular weight of 183 bp revealed that well No. 1 was negative, while wells 2-7 were positive for GPX1, and well M was for ladder 100bp.
The expression levels of GPx1 in liver tissue were assessed using real-time RT-PCR at three different time points: 19, 26, and 42 days of age. The amplification curves in Figures 9, 10, and 11 show the relative fluorescence intensity (ΔRn) across PCR cycles for eight samples representing four experimental groups: control (samples 1 and 2), Gumboro-vaccinated (samples 3 and 4), mixed group (Gumboro vaccine + Se-NPs; samples 5 and 6), and Se-NPs only (samples 7 and 8). On day 19 (Figure 9), early amplification was observed in the Se-NPs group (E4) compared to the control group (E1), indicating an upregulation of GPx1 expression. By day 26 (Figure 10), this trend became more pronounced, with the mixed group (E3) and Se-NPs group (E4) showing higher fluorescence signals and earlier Ct values than both the control (E1) and vaccinated-only (E2) groups. At day 42 (Figure 11), the amplification curves of the Se-NPs and mixed groups (E3 and E4) remained elevated and shifted leftward, reflecting sustained higher GPx1 expression, whereas the control and Gumboro-vaccinated groups (E1 and E2) showed comparatively delayed amplification.
Figure 9: Real-time PCR amplification curves of tested liver samples for the Glutathione Peroxidase-1 at 19 days old using One Step RT- PCR SYBR® Green Master Mix Kit. ΔRn is the magnitude of the normalized fluorescence signal generated by the reporter at each cycle during the PCR amplification.
Figure 10: Real-time PCR amplification curves of tested liver samples for the Glutathione Peroxidase-1 at 26 days old using One Step RT- PCR SYBR® Green Master Mix Kit. ΔRn is the magnitude of the normalized fluorescence signal generated by the reporter at each cycle during the PCR amplification.
Figure 11: Real-time PCR amplification curves of tested liver samples for the Glutathione Peroxidase-1 at 42 days old using One Step RT- PCR SYBR® Green Master Mix Kit. ΔRn is the magnitude of the normalized fluorescence signal generated by the reporter at each cycle during the PCR amplification.
As shown in table 4, the gene expression of GPX-1 for all sample collection periods showed the heights expressed 20.25 in the control group (E1) at 19 days old in contrast to the E2, E3, and E4 groups. At 26 and 42 days old, the last group (E4) showed the heights expressed 23.35 and 22.55 for the gene in contrast to the other groups.
Table 4: Cycle Threshold (CT) for GPX-1 gene expression in different liver samples for multiple sampling procedures
|
Sample
|
CT means 19 days old
|
CT means 26 days old
|
CT means at 42 days old
|
|
Sample 1
|
20.4
|
20.25
|
26.1
|
25.80
|
24.1
|
24.45
|
|
Sample 2
|
20.1
|
25.5
|
24.8
|
|
Sample 3
|
21.3
|
20.85
|
25.1
|
24.60
|
23.9
|
23.35
|
|
Sample 4
|
20.4
|
24.1
|
22.8
|
|
Sample 5
|
21.0
|
20.70
|
22.9
|
24.50
|
23.1
|
22.70
|
|
Sample 6
|
20.4
|
26.1
|
22.3
|
|
Sample 7
|
25.2
|
25.55
|
25.1
|
23.35
|
23.3
|
22.55
|
|
Sample 8
|
25.9
|
21.6
|
21.8
|
CT: Cycle Threshold; samples 1-2: (E1: Control); samples 3-4: (E2: Gumboro vaccinated)); samples 5-6: (E3: Mix); samples 7-8: (E4: Se-NPs).
Discussion
The infectious bursal disease is one of the serious economic and epidemiological problems on a large production scale. The disease causes direct and indirect losses resulting from immunity suppression. The above excuses the systematic use of prophylaxis in poultry flocks against the disease (37). At all sampling periods, no significant difference was observed in the follicle length and width, cortex thickness, and medulla length in the vaccinated group (E2) in contrast to the other groups. This may be attributed to the (live attenuated vaccine) exhibiting poor immunity response even with the negative titer of ELISA at the first 3 weeks due to the neutralization remaining of the antibody vaccine activity (23,38), bird age, dose of the intermediate vaccine, experimental condition, periods of it and species of chickens (39,40).
Morphometric results revealed a significant increase in the follicle and medulla length in the groups supplemented with Se-NPs (E3 and E4) material when compared to the other groups; nano-material enhances immunity (41) and improves bursa lymphatic follicular area, size of the follicle, lymphocyte cell concentration inside bursa of Fabricia and the number of producing antibodies cell (42). Furthermore, the Se-NPs stimulate the follicles to produce several lymphocyte cells that help improve the bird’s immune response (43). As an important trace element, selenium is essential for the antioxidant system synthesis (GPX-1), which blocks oxidative injury. The current study delineated the protective effects of Se-NPs in birds vaccinated with IBV. Liver enzyme expression helps to understand the functionality of the liver. The low enzyme level indicates the healthy function of the liver. Se-NPs increase the production of Glutathione peroxides (GPX1), which improves the anti-inflammatory responses, immunity statutes, repair of the DNA, and reinforces the resistance to diseases (44). The nanomaterial can reduce oxidative stress by eliminating the excessive production of free radicals and reducing stress indicators in animals, including birds. Selenium stimulates the immune system, improves bird productivity, and protects body cells and membranes from oxidative damage (45). The GPX-1 gene controls the production of enzymes, including glutathione peroxidase. Which protects body cells from damage free radicals) 46). Sunde and Hadley (45) reported that selenium feed additives have significantly increased liver enzymes (GPX-1 and GPX-4) in male turkeys. In the present work, we found that the level of GPX-1 increased in the Se-NPs (E4) group. We can assume that Se-NPs promote anti-oxidant activity, which ultimately prevents hepatocytes from peroxidation of lipids and reduces the level of MDA (47,48). The protective role might be mediated by a specific type of selenoprotein, such as GPX. These proteins reduce the oxidative stress. Therefore, the current result concludes that the hepatocyte protective effects against vaccine stress may be related to selenium modulation up-regulation of GPX-1 of broiler chickens. No significant changes in the expression of GPX-1 in the liver tissue of the vaccinated bird suggest that our experimental results' slight differences may be due to the vaccination stress factor, which leads to decreased growth performance, antioxidant levels, and ROS amplified levels (49), oxidative stress impact specific liver enzymes, particularly ALT, AST and GSK that regulate the synthesis of glycogen (50,51), additionally to the doses and type of vaccine, point time and experimental condition (52,53).
Conclusion
The current study describes Se-NPs as nutritional material supplemented in chicken vaccinated with infectious bursal disease. We found that birds’ administration of Se-NPs at 0.3 mg/kg had a good effect on the exhibition of the bursa of Fabricius morphometric immune response and increased GPX-1 RT-PCR expression in the liver tissue of these birds. However, the intermediate plus strain vaccine did not have a positive effect on the bursal morphometric and gene expression of GPX-1.
Acknowledgments
The authors express their sincere appreciation to the Faculty of Veterinary Medicine at the University of Mosul for their valuable support of this research.
Interest Collision
The authors proclaim no interest in conflicts.