Introduction
Meat is highly consumed throughout the world; in developing countries, meat is accounted as a source of protein in addition to its organoleptic features (1); the production is necessary to meet the requirements, and genetic modification has recently been used to yield a high meat production and to reduce the impact of the high cost of meat by adding vegetable protein sources (2-4). The most vegetable protein used in the meat industry is soybean protein, which has high water-holding capacity and emulsifier properties improving the final meat product texture. Additionally, soybean protein in meat production indicates reduced cholesterol levels showing health benefits (5,6). Although many GMOs are introduced in meat production, it’s still under unacceptable level by consumers due to some ethical and health causes (7,8); some countries restricted the use of soybean protein to a certain limit, the US regulation permits a level of 2% for sausage, 0.04% of soybean in mortadella and hot-dog in Brazil (9,10). Screening of trace amounts of soybean in some meat products is necessary to assess the adulteration in some meat products that are widely consumed in developing countries (2,11,12). Polymerase chain reaction (PCR), as a sensitive method was used to detect the soybean in meat (13,14). For routine screening of GMOs in meat, the Cauliflower mosaic Virus 35S gene (CaMV 35S) is taken into account as a promoter gene along with Nopaline Synthase (T-nos) as the terminator gene. The screening of GMO additives in food has been handled by many studies (15-18).
The target of the current investigation was designed to screen (for the first time) the presence of GMO materials in some meat products commercially available in the Mosul city market depending on the presence of RR genes; sequencing of DNA from RR genes is described in the current paper.
Materials and methods
Ethical approval
The study protocol was approved by the Institutional Animal Care and Use Committee at the College of Veterinary Medicine, University of Mosul, and included an authorized ID of UM.VET.2024.045 at 9.7.2024.
Samples
One hundred twelve samples of meat from various sources were collected randomly from Mosul city markets in the period between August to December 2024. The collected meat samples were distributed to 64 samples of processed meat and 24 samples each of imported meat and local meat, including both beef and poultry meat. The processed meat included luncheon meat samples, sausage meat samples, and mortadella. All samples were transported to the lab using clean containers and preserved at chilling temperatures till analysis was done.
DNA extraction
DNA was extracted from meat samples according to a DNA extraction kit (Add Bio, Korea). 20 mg of meat samples were held in the bottom of a 1.5 ml microcentrifuge tube and mixed with 200 μl lysis buffer, 20 μl proteinase K (20 μg/ml), and incubated overnight at 56°C for tissue lysis. After incubation of the mixture for 10 minutes at 72°C, 200 μl of binding solution was added, mixed with vortex, and incubated for 10 minutes. Centrifugation was done at 8000 rpm for one minute, and the supernatant was transferred into the new 1.5 ml tube. Then 200 μl ethanol 100% was added to the mixture, put into a mini spin column for 15 seconds, and centrifuged at 13000 rpm for 1 min. Following centrifugation, the DNA was washed and centrifuged twice using 500 μl of both wash buffer 1 and 2 at 13000 rpm for 1 min to evaporate the ethanol residues. The DNA was eluted with 100 μl of elution buffer and then incubated for 1 min at room temperature; the obtained DNA was stored at −20°C. DNA extracted from meat samples was screened for 35S Promoter and nos Terminator region using primers provided by (Macrogen/Korea) to identify GM DNA in meat and provide a specific gene represented by Roundup Ready soybean gene for conventional PCR assay (Table 1).
Table 1: Primers used to screen GMO additives in meat
|
Primers
|
Sequence (5– 3)
|
GM gene
|
DNA size (bp)
|
Temperature (ºC)
|
References
|
|
35S -F
|
CCACGTCTTCAAAGCAAGTGG
|
P-35S
|
123
|
60
|
19
|
|
35S -R
|
CCTCTCCAAATGAAATGAACTTCC
|
|
nos -F
|
GCATGACGTTATTTATGAGATGGG
|
T-nos
|
118
|
60
|
19
|
|
nos-R
|
GACACCGCGCGCGATAATTTATCC
|
|
RR-F
|
CAT-TCC-CGG-CGA-CAA-GTC-
|
RR
|
172
|
60
|
20
|
|
RR -R
|
TTG-ATG-ACG-TCC-TCG-CCT-TC
|
PCR Reactions
PCR assay has been used to identify 35S, nos, and RR genes. The reactions were accomplished using 1 μl from each pair of primers (F and R), 12.5 μl of master mix (Add Bio, Korea), and 2 μl of DNA template was added followed by adding 8.5 μl of nuclear-free water to achieve 25 μl total volume of final product. PCRs reactions were done in Thermocycler (BioRad, USA) using proper thermal cycling conditions, including predenaturation at 95ºC for 5 minutes followed by subjected DNA to heat at 95ºC for 30 s (35cycles), the primer annealed at 60 ºC for 30 S, 45 s extended at 72 ºC, and 10 min ultimate extension at 72 ºC. Target DNA bands were visualized by applying gel electrophoresis using 1.5% agarose gel to separate amplified DNA and imagined fragments. DNA ladder 100 bp as a marker was loaded into wells along with target DNA. DNA amplicons were illustrated using a UV transilluminator with gel captured using the Gel Documentation System (BioRad, USA),
DNA Sequencing
The amplicons of Roundup ready soybean gene (RR) were excised from the agarose gels and purified; the sequences were assessed according to Sanger dideoxy sequencing at NCBI server with BLAST (Basic Local Alignment Search Tool) software. The structure of phylogenetic analysis was done using the Maximum likelihood method depending on the Tamura-Nei model in MEGA12 software.
Results
The screening results of genetically modified additives in meat and meat products sold in Mosul city markets revealed the presence of 22.32% of 35S promoter gene and 2.68% of the nos terminator gene, while the specific Round ready soybean gene revealed 29.46%, Higher percentage for P-35 S gene, T-nos gene with RR soybean gene were present in processed meat reached to 28.13%, 4.69% and 37.5% respectively compared to other meat samples (Table 2). The distribution percentage of specific RR soybean gene in processed meat was 73% compared to 15% and 12% in both imported and local meat, respectively (Figure 1). The screening of GM additives in beef meat samples showed that mortadella has 50% 35S promoter followed by luncheon 41.67% associated with a high percentage of RR soybean gene in beef luncheon 75% then mortadella 50% and beef sausage 33.33% (Figure 2). Poultry meat samples recognized the existence of GM additives genes in luncheon at 58.33% and imported poultry meat at 33.33%, followed by local meat at 25% for the P-35S promoter gene. In comparison, the RR soybean gene were recognized with the same percentage, 50% in both of poultry luncheon and mortadella, followed by 41.67 and 33.33% in imported and local poultry meat subsequently. Still, the poultry sausage detected less RR soybean gene 16.67% (Figures 3-6). The sequencing of the RR gene revealed were nucleotide identity percentage of 92.96% recorded in the Genebank database from transgenic plants from different countries, including Belgium, USA, China, and Switzerland (Table 3). A phylogenic tree of RR gene in six positive samples from our study was constructed and bootstrap analysis with 1000 re-samplings. The phylogenetic tree illustrates the evolutionary relationship among our positive samples with a high degree of genetic similarity, especially the RR-55 and RR-6, by a bootstrap value of 93% (Figure 7).
Table 2: Screening of GM additives in meat at Mosul city
|
Samples
|
No.
|
P-35 S
|
T-nos
|
RR
|
|
Positive No.
|
%
|
Positive No.
|
%
|
Positive No.
|
%
|
|
Processed meat
|
64
|
18
|
28.13
|
3
|
4.69
|
24
|
37.5
|
|
Imported meat
|
24
|
4
|
16.67
|
-
|
-
|
5
|
20.83
|
|
Local meat
|
24
|
3
|
12.5
|
-
|
-
|
4
|
16.67
|
|
Total
|
112
|
25
|
22.32
|
3
|
2.68
|
33
|
29.46
|
Figure 1: Distribution of Roundup-ready soybean gene in meat and meat products in Mosul city.
Figure 2: Prevalence of genetically modified additives genes in beef meat and meat products.
Figure 3: Prevalence of genetically modified additives genes in poultry meat and meat products.
Figure 4: Gel-electrophoresis image displaying the amplified product of the P-35S gene for GM additives in meat. Lane 13,16,17 positive with a product size of 123 bp, Lanes 1-12,14-15,18 represent the negative sample, and lane 19 represents the negative control. The Lane M is the DNA marker 100 bp.
Figure 5: Gel-electrophoresis image displaying the amplified product of the T-nos gene for GM additives in meat. Lanes 8,9 positive with a product size of 118 bp, Lane 1-7,10-17 represents a negative sample, and Lane 1 represents the negative control. The Lane M is the DNA marker 100 bp.
Figure 6: Gel-electrophoresis image displaying the amplified product of RR soybean gene for GM additives in meat, Lane 4,6,13,14,16 positive samples with a product size 172 bp, Lane 1-3,5, 7-12,15,17-18 represents negative samples, lane 19 represents the negative control. The Lane M is the DNA marker 100 bp.
Table 3: Percentage distribution of Roundup-ready soybean gene depending on the blast in GenBank of NCBI
|
Scientific Name
|
Query
|
Identity
|
Country
|
Accession Number
|
|
Gateway expression vector pAGRIKOLA-CATMA1a11610
|
13
|
92.96
|
Belgium
|
LT724735.1
|
|
Expression vector pOsAct2-1-Tnos
|
13
|
92.96
|
USA
|
EU259514.1
|
|
Gateway expression vector pAGRIKOLA-CATMA4a19057
|
13
|
92.96
|
Belgium
|
LT725408.1
|
|
Cloning vector pMono_T-vector
|
13
|
92.96
|
USA
|
JN681269.1
|
|
Transformation vector pC23HC
|
13
|
92.96
|
China
|
EU327493.1
|
|
Cloning vector pCASP1::CASP1:mTurquoise
|
13
|
92.96
|
Switzerland
|
HQ699545.1
|
|
Cloning vector pSOL9LHGRC
|
13
|
92.96
|
Germany
|
JX185747.1
|
Figure 7: Phylogenic analysis of RR gene (6 samples) from our study (*) by MEGA12 software.
Discussion
Meat safety is an important concept related to consumers' health; nowadays, to cover the demands for meat consumption around the world, various strategies have been improved to increase production (21,22); therefore, genetically modified (GM) plant species have significantly elevated over the past years, and the GM remnants for both human and animal food proportionally rose. The study investigated for the first time the residence of the RR soybean gene in meat sold in Mosul city reached 29.46% which in agreement with the percentage of RR soybean gene in processed food in Malaysian markets (23) and 24% of processed meat in Serbian positive for both RR soybean gene and P-35S promoter (24) but it is less than the existence of RR soybean gene 43.75% in meat provided in Riyadh town confirmed the presence of specific GM additives represented by RR gene in poultry luncheon 66.67% more than in sausage 47.06% (25), consistent with another study in Syrian the permanence of GM additives in mortadella revealed high percentage to both of P-35S gene and RR soybean gene (26). The presence of target-specific Round ready soybean gene in processed meat consumed in Mosul city reaches 37.5%, close to the 38% of Hungarian food positive for soybean gene (27-29).
The differences may relate to the heat treatment of processed meats, which leads to decreased DNA quality and becomes, to a lesser extent, undetectable by the action of polymerase inhibitors (30,31). Earlier studies referred to that genetically modified soybean protein may added to processed meat as a trace ingredient during manufacturing to improve sensory traits and tenderness of products through its water-binding ability and its low cost compared to other protein sources (32-34) or it may enter the meat supply through animal diets which are derived from GM crops especially soybean and corn to attained healthier meat products; thus the meats from such animals could have a remnants of GM ingredients (35,36). The origin of soybean used as an additive in processed meat is imported from countries with a history of encouraging plant genetic engineering (24,28). Also, conventional PCR can be used as a sensitive technique to detect the common regulatory genes of genetic modification, including the P-35S promoter and T-nos terminator, as well as the specifically modified soybean gene additives (37). The phylogenic analysis suggests genetic differentiation compared to other global sequences referring to region evolutionary patterns and the strong bootstrap indicating high reliability of relationships; further research should be incorporated with a large number size to refine transgenic modification more accurately. Although the using of biotechnology to produce healthier meat (38,39), the availability of genetically modified products gave attention to monitoring these transgenic additives in meat products and applying legislation recommended the labeling of meat products derived from these materials to save consumers public health and to detect meat adulteration earlier (40,13,2).
Conclusion
Various types of meat sold in our local markets with the high demand of consumers give us a new contact to monitoring about residues of GM additives in these meats. Genetically modified additives in meat are a term of significant debate, including ethical and regulatory considerations. The screening of GM additives in meat at the local market in Mosul city displayed the existence of GM additives in meat products without labeling refers to the addition of genetically modified ingredients; the GM additives may be added indirectly through ingredients to processed meats as fillers derived from genetic modified soybean or corn. Positive findings indicate a commercial adulteration and indicate that PCR assay is a useful molecular tool to identify GM additives. The finding suggests that it is necessary to monitor the GM additives in meat with the urgent need to establish a genetically modified legislation program, and checking the GM additives in meat products will be necessary to save consumers health.
Acknowledgment
The authors are grateful to the University of Mosul, College of Veterinary Medicine, for supporting the study.
Conflict of interest
The authors of the manuscript confirmed no conflict of interest during data analysis.