Introduction
One significant parasite infection in dogs is N. caninum. In cattle, the illness is clinically significant and can result in abortion (1,2). The most accurate method for determining the frequency of canine neosporosis is still serological surveys because oocysts are rarely discovered in dog feces (3,4). Neospora is a widespread protozoan illness that affects dogs worldwide (5), including Iraq (6,7). Reports on dogs in Baghdad showed that Iraq had 4% of home dogs and 15% (8,9). In Urmia, Neospora infections in dogs have been documented at a comparable prevalence of 27% (10,11). According to reports, N. caninum seroprevalence was 11% in Belgian dogs and 20% in dogs from China (12,13). Canines infected with the virus could be a significant source of N. caninum infections in livestock (14,15). Prior research has shown a correlation between the presence of dogs in the surroundings and abortion rates in cattle (16,17). Domestic and stray dogs in Iraq's rural areas frequently come into close contact with livestock, increasing the possibility that Neospora would infect these animals (18).
There are few serological or molecular investigations on Neospora infection in Iraqi dogs using genetic techniques, and we sought to ascertain the level of N. caninum infection in a Mosul-based canine community.
Materials and methods
Ethical approval
This research was accepted by the scientific board of the College of Veterinary Medicine at Mosul University; UM.VET.2024.064.
Animals and samples obtained
In this study, a total of 40 dogs from both sexes (males and females), different ages (6 months - 5 years), and lifestyles (stray and household). All dogs suffer from nervous signs, paralysis, and paresis, which were examined to detect the infection rate of N. caninum using conventional polymerase chain reaction (c-PCR). From October 2023 to July 2024, 5ml samples of the dog's blood were collected from the cephalic vein, buffy coats were separated from the whole blood, and then kept at -20 °C (19,20).
DNA extraction and amplification
Using a blood genomic DNA extraction kit, the buffy coat samples of all 40 dogs were extracted in accordance with the manufacturer's instructions. (Qiagene, Germany). Using specific primers, the forward primer was NP6 (5′- CAGTCAACCTACGTCTTCT-3′), and the reverse primer was NP21 (5′- GTGCGTCCAATCCTGTAAC-3′), the extracted DNA was amplified using the c-PCR technique. The Nc5 gene of N. caninum was amplified using standard PCR procedures. 0.5 μL of each primer (10 pmol/μL), 11.5 μL of 2× Taq PCR mix (Amplicon, Odense, Denmark), 30 ng of template DNA, and 12.5 μL of ddH2O were used in the PCR, the reaction volume of 25 μL. The PCR's temperature profile consisted of one cycle lasting five minutes at 95°C, thirty cycles of fifty seconds each at 94°C, thirty seconds at 55°C, fifty seconds at 72°C, and one cycle lasting four minutes at 72°C. To visualize the PCR results, they were separated on 1.5% agarose gel and stained with GelRed nucleic acid gel dye under a BioDoc gel documentation system. The amplified DNA fragment was predicted to be around 328 bp (21).
Use of phylogenetic analysis and DNA sequencing
The South Korean company Macrogen Inc. received the positive PCR samples and used the Sanger sequencing technique to sequence them. In summary, the corresponding primers and 25 µl of the target Nc5 gene's PCR result were delivered. The sequencing process resulted in text files in the FASTA format. The NCBI GenBank received a selection of the sequences, which were then registered and assigned unique accession numbers (22).
Statistical analysis
With the IBM-SPSS Statistics (Version 22) software, the two-sided Chi-square and Fischer's exact tests were used to determine the variation in infection rate among the different risk factors. Using factors with P values <0.05, deemed significant, is advised by Fisher exact test P value results if the anticipated cell value in the Chi-square test is less than 5. Using two by two tables and the Epi-InfoTM 7 program (Version 7).
Results
In this study, the infection rate was 37.5% (15/40), using the c-PCR technique, which was about 328 bp (Figure 1). The proportion of dogs in the current study showed a significant difference between dog's lifestyles. There was a significantly higher (P<0.0000) among stray dogs, 87.5% (OR: 56.00 times, CI: 5.88-532.95), compared to household dogs, 4.7%. Regarding the gender factor, this study noted that The N. caninum infection rate was not substantially (P<0.0217) greater in canines that are male 54.5% (OR: 6.00 times, CI: 1.34-26.80), compared to female dogs 16.7%. The study also found that dog ages differed significantly. In dogs older than or equal to the test subjects, the infection rate was considerably (P<0.0432) and (P<0.0302) higher. One year to more than an equal 2 years 46.6% (OR: 9.62 times, CI: 0.97-94.54), and 53.8% (OR: 12.83 times, CI: 1.26-130.51) respectively, compared to dogs less than 1 year 8.3%. Moreover, this study demonstrates significant differences between dog breeds. The prevalence of N. caninum infection was considerably (P< 0.0002) higher in large breed dogs, 68.4% (OR: 20.58 times, CI: 3.58-118.32) compared to small breeds, 9.5% (Table 1).
Figure 1: Gel electrophoresis for Nc5 gene of N. caninum. Lane 1 represents 100 bp DNA marker; lanes (1-4,6-18) are positive samples; lane 19 is negative control.
Table 1: Odds ratio of dog factors associated with the infection rate of N. caninum
|
Factors
|
No. tested cases
|
Positive n (%)
|
OR
|
CI
|
P Value
|
|
Animals’ management
|
|
|
|
|
|
|
Household
|
21
|
1 (4.7) a
|
1
|
5.88-532.95
|
0.0000
|
|
Stray dogs
|
19
|
14 (87.5) b
|
56.00
|
|
Gender
|
|
|
|
|
|
|
Females
|
18
|
3 (16.7) a
|
1
|
1.34-26.80
|
0.0217
|
|
Males
|
22
|
12 (54.5) b
|
6.00
|
|
Age
|
|
|
|
|
|
|
< 1 year
|
12
|
1 (8.3) a
|
1
|
0.97-94.54
1.26-130.51
|
0.0432
0.0302
|
|
≥ 1 year - 2 years
|
15
|
7 (46.6) b
|
9.62
|
|
≥2 years
|
13
|
7 (53.8) b
|
12.83
|
|
Breed
|
|
|
|
|
|
|
Small breed
|
21
|
2 (9.5) a
|
1
|
3.58-118.32
|
0.0002
|
|
Large breed
|
19
|
13 (68.4) b
|
20.58
|
OR: Odds ratio, CL: Confidence of interval, Different letter (a, b) means significant under P<0.05.
The results of the Nc5 gene sequencing revealed a genetic sequence for the samples (n=15) that were diagnosed in Mosul and delivered to Macrogen Company in South Korea. It was found that there were only four sequences out of the total were registered in NCBI GenBank with the accession number PQ084657.1, PQ084658.1, PQ084659.1, PQ084660.1 (Table 2). Based on the alignment of multiple sequences in MEGA11 software, according to the study. Table 3 indicates that the alignment score between the derived local sequences was 100. Additionally, the outcomes of individual sequencing analyses of local sequences using the Blastn procedure in the (nr/nt), N. caninum in dogs is quite similar to sequences with numbers recorded in the GenBank of various nations, including Iran, which is 98.04%-100% identical MT709295.1, MT709296.1, MT955656.1, MT766316.1, MT766317.1, and MT955657.1 and Iraq OP244818.1 (Table 4). After nucleotide sequence reconstruction using MEGA 11-Bootstrap analysis, the phylogenetic tree of the local genetic sequences of N. caninum recorded in the NCBI Genbank revealed highly phylogenetic properties and an extremely close evolutionary relationship 99.04-100% to other global sequences of the same strains recorded in the Genbank for different countries, such as Iran and Iraq (Figure 2).
Table 2: The N. caninum sequences NCBI GenBank accession numbers in dogs in Mosul city, Iraq
|
Accession numbers
|
Sequencing 5'..........................................................'3
|
|
PQ084657.1
|
CCCTTCCCTCGTCCGCTTGCTCCCTATGCATAATCTCCCCCGTATCAGCGCCGCCGGTGTTGCCTCAACACAGAACACTGAACTCTGGATAAGTATCATTGACACACTGTCCACACCCTGACGCAGGCTGATTTCAACGTGACGAATGACTAACCACAAACCACGTATCCCACCTCTCACCGCTACCAACTCCCTCGGTTCACCCGTTCACACACTATAGCCACAAACAAAAAAGGAGCCTTGCTGCCGCAGGCTGCGCCCAACAACGACACGTCCGCATACCAACACGTTACAGGATTGGACGC
|
|
PQ084658.1
|
CCCTTCCCTCGTCCGCTTGCTCCCTATGCATAATCTCCCCCGTATCAGCGCCGCCGGTGTTGCCTCAACACAGAACACTGAACTCTGGATAAGTATCATTGACACACTGTCCACACCCTGACGCAGGCTGATTTCAACGTGACGAATGACTAACCACAAACCACGTATCCCACCTCTCACCGCTACCAACTCCCTCGGTTCACCCGTTCACACACTATAGCCACAAACAAAAAAGGAGCCTTGCTGCCGCAGGCTGCGCCCAACAACGACACGTCCGCATACCAACACGTTACAGGATTGGACGC
|
|
PQ084659.1
|
CCCTTCCCTCGTCCGCTTGCTCCCTATGCATAATCTCCCCCGTATCAGCGCCGCCGGTGTTGCCTCAACACAGAACACTGAACTCTGGATAAGTATCATTGACACACTGTCCACACCCTGACGCAGGCTGATTTCAACGTGACGAATGACTAACCACAAACCACGTATCCCACCTCTCACCGCTACCAACTCCCTCGGTTCACCCGTTCACACACTATAGCCACAAACAAAAAAGGAGCCTTGCTGCCGCAGGCTGCGCCCAACAACGACACGTCCGCATACCAACACGTTACAGGATTGGACGC
|
|
PQ084660.1
|
CCCTTCCCTCGTCCGCTTGCTCCCTATGCATAATCTCCCCCGTATCAGCGCCGCCGGTGTTGCCTCAACACAGAACACTGAACTCTGGATAAGTATCATTGACACACTGTCCACACCCTGACGCAGGCTGATTTCAACGTGACGAATGACTAACCACAAACCACGTATCCCACCTCTCACCGCTACCAACTCCCTCGGTTCACCCGTTCACACACTATAGCCACAAACAAAAAAGGAGCCTTGCTGCCGCAGGCTGCGCCCAACAACGACACGTCCGCATACCAACACGTTACAGGATTGGACGC
|
Table 3: Alignment score between the obtained sequences of N. caninum using the Multiple Sequence Alignment Program
|
Sequences accession number
|
Alignment score
|
|
PQ084657.1
|
100
|
|
PQ084658.1
|
|
PQ084659.1
|
|
PQ084660.1
|
Table 4: N. caninum sequences from the local area that are similar to other sequences in GenBank using NCBI BLASTn
|
Sample
|
Query Cover %
|
Identic Number %
|
GenBank
|
Country
|
|
PQ084657.1
PQ084658.1
PQ084659.1
PQ084660.1
|
100
|
100
|
MT709295.1
|
Iran
|
|
100
|
100
|
MT709296.1
|
Iran
|
|
100
|
100
|
MT955656.1
|
Iran
|
|
100
|
100
|
MT766316.1
|
Iran
|
|
100
|
100
|
MT766317.1
|
Iran
|
|
100
|
99.35
|
MT955657.1
|
Iran
|
|
100
|
98.04
|
OP244818.1
|
Iraq
|
Figure 2: N. caninum strains phylogenic tree from Mosul, Iraq (*).
Discussion
Dogs are the sole hosts of N. caninum and have a major role in the epidemiology of neosporosis (23). Based on the research methods, there are differences in the prevalence of N. caninum in dogs across different locations, the number of animals examined, the geographical location and the number of dogs, either at home or stray (24). When dogs are fed raw meat instead of ready-to-eat items, their risk of contracting Neospora infection is increased (25). A low rate of Neospora virus frequency in dogs from a Baghdad governorate was documented 10% (26). In comparison to reports in this study, While Turkey reported 2% (27), and 3.8% showed (28), the prevalence rate of Neospora infection was lower here (29). While most previous studies considered seropositivity using a highly precise specific modified agglutination test and an immunofluorescence antibody assay (IFA) with a very low cut off, the current study determined the dogs' Neospora susceptibility. This could have decreased our study's seropositivity rate for Neospora compared to earlier ones. Other reasons are the presence of other hosts of N canium and the bad habits of the farmer. They provide placentas to guard dogs which play a critical role in spreading parasites and completing the life cycle.
Several epidemiological investigations in parts of the world have indicated a rising pattern of Neospora positivity with age, The older canines in the current investigation had a higher prevalence rate for N. caninum. The positivity of infection in dogs with increased animal age, are consistent with the positive seroprevalence of increasing age above 26 years; the highest infection rate was found in the older dog group, while the lower infection rate was found in younger dogs (30). Furthermore, Gozdzik et al. (31), in their study on dogs in central Poland, discovered that the prevalence of infection increased with age, with the age group over 10 years showing the highest infection rate. Meanwhile, Al-Majali et al. (32) found that the seroprevalence of the parasite was significantly higher in sheep and goats older than 4 years.
The results showed 0% in indoor dogs compared to outdoor dogs 78.9% (30). They found that dogs raised in rural regions had a considerably higher infection rate of N. caninum 18.17% than dogs raised in urban settings 11.33%. This intriguing discovery could be explained by dietary practices such as consuming raw meat containing parasite cysts, living conditions variations, and welfare (30). Dogs in both urban and rural settings are likely to become infected by eating raw or undercooked beef, and there have even been reports of bitches passing the infection vertically to their offspring (33). However, dogs in rural and environment conservation regions have a higher chance of predating possibly infected small mammals and birds. They may also have access to the carcasses of wild animals and livestock, as well as aborted fetal tissues (34).
Certain research has indicated a correlation between gender and positivity. Males recorded higher positivity than females, it should be emphasized that positivity only reflects Neospora exposure, and that a very small percentage of positive dogs are releasing oocysts into the environment (35). In an assessment of 132 dogs' stool samples in Australia, King et al. (36). Other parameters in this study showed that 0% of infection was shown in small breeds of dogs when compared high percentage of infection in large breeds, this parameter We did not find a study that addressed this, but through our experience in the field of veterinary work, we can find that the reason for this is due to the lack of exposure of small breeds to the stages of development of the parasite in its life cycle, due to the decline in its breeding inside homes, In addition, dogs of large breeds are often used for guarding or protecting herds of livestock, which increases the chance of them being exposed to the parasite. Dogs of small breeds are often given regular attention in veterinary examinations and treatments, which is one of the fundamental reasons for the lack or absence of their infection.
In the current investigation, no dog that was examined tested positive using the molecular approach, and no dog's buffy coat had any parasite DNA. This would suggest no acute neosporosis in any of the dogs under study. It can also indicate that a buffy coat specimen is not a good fit for molecular detection of Neospora in dogs (21). The four strains found in the study belong to the same subgroup and are part of certain worldwide registered species, according to the results of the phylogenetic tree of the nc5 gene (22). This association proves that these animals are highly genetically related (37). In addition, the study's isolated strains (38) showed genetic diversity between them according to where they are in the phylogenetic tree (39). From a genetic perspective, the divergence and convergence of local and global strains suggest that they have a shared evolutionary origin, and geography plays a part in this (40).
Conclusions
Nineveh province has more prevalent parasites in dogs with nervous indications than in dogs unaffected by N. caninum.
Acknowledgment
The veterinary teaching hospital provided invaluable assistance, and the authors are grateful to the University of Mosul's College of Veterinary Medicine for its financial support of our work.
Conflict of interest
The manuscript's authors affirm that there is not a conflict of interest.