Introduction
Cryptosporidium is an intestinal protozoan parasite, accountable for cryptosporidiosis. Cryptosporidium species can spread a broad variety of hosts vertebrate, enclosing persons. An infection with Cryptosporidium is linked to serious, perhaps fatal illnesses in immunocompromised patients and among the primary reasons of diarrhea and death in kids less than five years (1,2). Because they can infect a variety of hosts (3). Some species, like C. parvum, characterized by lacking specificity of host. Because of their tremendous genetic variety, the later species actually exhibit significant adaptive skills (4). Different species of Cryptosporidium identified in sheep by molecular examination of fecal samples, there are C. parvum, C. xiaoi, C. ubiquitum, C. fayeri, C. hominis, and C. andersoni (5). Because animals can serve as reservoir and rigin of zoonotic cryptosporidiosis, the disease has become an issue for both public health and veterinary (6,7). Transmission of the Cryptosporidiosis via the consumption of oocysts from the infected Humans by through contaminated of food, water and pasture, Cryptosporidium infections indifferent animals and peoples, having significant importance for both public health and veterinary medicine. C. parvum is mostly responsibility for producing infections and dissemination via the pollution of drinking water on its surface (rivers, lakes, springs and streams) or oocysts - contaminated water for swimming which are the main infection sources among animals and individuals (8-11). Most diarrheal infections have the same cause in both peoples and animals in Cryptosporidium infection. It is held responsible for 60% of documented outbreaks of water-borne and presents a serious concern to drinking water in developed country populations (12). The significance of cryptosporidiosis in farm animals, particularly sheep, is that it causes diarrhea solely from this parasite and can also coexist with other infections that impact the animals' health and productivity. Diarrhea is the main clinical indicator of infection in sheep, although other symptoms include dehydration, cramps, abdominal pain, sadness, listlessness, unthriftiness, and weight loss. As a result, morbidity and mortality rates are high worldwide (13,14). Sheep are considered to be a principal source of infection with Cryptosporidium, either directly or by environmental contamination, and they may transmit the zoonotic Cryptosporidium spp. that causes clinical symptoms in humans (15,16). Different techniques were used in an investigate of Cryptosporidium. Morphological identification with a 100× lens yields a direct microscopic method. It employs a variety of staining methods, including auramine phenol and cold or hot modified Ziehl-Neelsen, to identify oocysts that contains four sporozoites (17). Although the microscopical technique is an excellent instrument as well as very cost-effective, it needs information and skilled diagnostic staff to reduce false-positive outcomes and therefore, it may take a lot of time. In addition, the microscopical examination unable to detected parasites species, by using the traditional microscopic technique (modified Ziehl-Neelsen staining), Al-Zubaidi (18) found the infection rate with Cryptosporidium 37.77%. However, using the PCR analysis, the infection rate is recorded 48. 88% of cases with highest sensitivity in sheep in Baghdad city.
The variations in infection rats were attributable to a number of components, including systems of management and techniques of rearing, unaltered factors of risk, including aged, conditions in the environment, and animal breed, and altered variables of risk, such as technique of sampling and Methods for detection. Thus, purpose of this scientific research to evaluation the detection of Cryptosporidium spp in sheep by examination of fecal samples which are collected from various regions of Nineveh Province, Iraq. Utilizing microscopic examination and molecular techniques, using 18S rRNA sequences, it also seeks to record the phylogenetic diversity of Cryptosporidium across species.
Materials and methods
Ethical approval
The study was done in acceptance with the rules of ethics established by Institutional Animal Care and Use Committee at Mosul University, College of Veterinary Medicine under at number of approved animals: 250 at 9/7/2024.
Study design
Current study was done at sheep with and without diarrhea in different regions in Nineveh Province -Iraq from the beginning of August 2024 to the end of February 2025 of both genders, with various ages.
Collection of fecal samples
Two hundred Samples of feces were taken from sheep in various regions in Nineveh Province -Iraq. Each sample was placed in a cleaned plastics container, numbered on the label and the day of samples collection, then transported in cooling box, to the parasitology laboratory for examination.
Microscopic examination
Direct method and Modified Ziehl-Neelsen stain was done (19-21). And the oocysts which were measured by using an ocular micrometer. The severity of the infection was determined by examining fecal smears by different methods. The oocysts were counted by light microscopy under 100X magnification. If 5 or more oocysts were found in a single microscopic field, the infection was considered heavy. If 1-4 oocysts were found in a single microscopic field, the infection was considered mild. The examination was carried out on more than 40 observations in different microscopic fields (22). All fecal samples were positive by microscopical examination have been kept at -20ºC for later DNA extraction.
Molecular examination and processing
Sixty-five positive fecal samples were severing infection by microscopic examination were used for molecular detection of Cryptospordium using PCR technique. The conventional PCR process was accomplished for investigate species of Cryptosporidium, according to18s ribosomal rRNA gene in sheep fecal samples by multiple steps:
DNA extraction from fecal samples
The fecal samples underwent extraction of nucleic acid by using DNA extraction kit provided with company Geneaid from Bioneer-Corporation, Korea (Accu-Prep®stool-DNA Extraction kit). It was carried out as follows: 200 μl the parasite precipitate transferred in to an Eppendorf tube 1.5 ml, 200 μl were included in Eppendorf tube containing the Lysozyme enzyme at a concentrating of 0.8 mg/200 ml, and using Vortex the mixing was carried out. Then tube was incubation at 37°C for about Half an hour, during period of incubation the tube was inverted each three minutes. Then add 20 μl Proteinase K and mix by Vortex. At 60°C incubate the mixture was incubation for ten minutes. Add 200 μl GB buffer solution and mixing by using Vortex then incubate at 70°C. Add 200 μl absolute ethanol then mix by hand, and transport the mix to the GD tube fixed in collecting tube then discard for 30seconds at 16000g and throw the filter fluid, then add 600 μl of the solution for washing and discard at identical speed and time as mention above and discard the precipitate, then centrifuge again for 3 minutes in order to eliminate all remnants of the solution for washing. Transfer GD column to a clean tube 1.5 ml, add 100 μl of dissolution fluid, quit for three minutes, then discard for 30 seconds at 16000 g, then Store the DNA until you need it.
Agarose gel preparation and DNA electrophoresis
In order to Prepare of 1% agarose gel. By dissolved 0.5 gram of agarose grind in 50 ml of X1 TBE (Tris/Borate/EDTA, is a buffer solution) and safe red dye 3 microliters were adding. This carried out with continuous stirring over a heat source up until it boils and let cooling at temperature between 50 and 60 degrees Celsius, after that pour the gel fluid into the container of the transfer apparatus after getting the comb installed to create the gel's outer wells at the gel's edges, Considering that the pouring needs to be completed gently to Prevent bubbles from forming, and if they are present, they are eliminated by using a pipette, then the gel is remains for solidifies. Then the container is positioned in electrophoresis containing a suitable quantity of X1 TBE solution, then the comb is raised carefully. The samples of immigration were preparation by mixing 5 μl of the DNA sample with 3 μl of the solution for loading. After that migration apparatus was worked for 2 - 1.5 hours via moving by A current of electricity with a differential voltage of 5volts per centimeter. Then gel was scanned under UV light using a Gel Records instrument to be prepared to view the DNA bands and also results of PCR reaction.
PCR technique
Detection of amplified region by addition 4 μl template DNA and 1 μl of every gene -specific primer adding to materials of the Master mix (Table 1) utilizing PCR amplification and electrophoresis (23,24). Later all reaction tubes were placed through the process thermocycler to carry out the multiplication reaction utilizing the specific reactions program (Table 2).
Table 1: Primers for Cryptosporidium spp. using 18s rRNA
|
primer
|
Sequence
|
|
Cry-F
|
TGGCACCAGAATCAGCTGAA
|
|
Cry-R
|
GACAGGTTGAGTTGGAGCAGA
|
Table 2: PCR program
|
Phase
|
ºC
|
Period
|
Cycle (n)
|
|
Initial denaturation
|
95
|
6 min.
|
1
|
|
denaturation
|
95
|
1.30 min.
|
|
Annealing
|
56
|
1.30 min.
|
35
|
|
Extension
|
72
|
2 min.
|
|
Final extension
|
72
|
5 min.
|
1
|
DNA sequence analysis
Following some positive amplification of conventional PCR results (320 bp), the DNA sequencing procedure was accomplished, later these samples were sent to Korea to carry out DNA sequencing and evaluation of phylogenetic tree utilizing (MegaX version) as well as accounted of the distances in evolution. Then determined isolates of Cryptosporidium species were transferred in to the NCBI-GenBank to recorded the accession no.
Results
Microscopic results
In This study results showed the rate of Cryptosporidium infection according to the microscopical examination was 52% (104/200) based on its Modified Ziehl-Neelsen stain, the size 4-6 µm of the oocysts (Figure 1). This investigation revealed the severity infection rate with Cryptosporidium spp. in sheep was 62.5%, while the percentage of infection with mild infection in sheep was 37.5% of the total 104 samples. The incidence of severe infection varied, reaching more than 5 oocysts per microscopic field, while in mild infection the number of oocysts reached 1-4 oocysts per microscopic field.
Figure 1: Oocysts of Cryptosporidium, MZN stain, 100X.
Results of molecular examination
Results of molecular examination revealed that all the samples(65 samples) which were sever infection by microscopical examination and All samples showed positive by PCR reaction. The results of DNA sequencing were done to confirmed results of conventional PCR for detection of Cryptosporidium spp. according 18S-ribosmal RNA gene. Where, the nucleotides sequence was examined through NCBI (BLAST analysis data base) that in line with the nucleotide inquiry with 18s ribosomal RNA, gene of Cryptosporidium species that include C. parvum, C. hominis, C. ubiquitum (Figures 2-4). Six strains were registered under the name RFMN-2024, which received the registration number Gen Bank accession number (Table 3).
Figure 2: DNA extraction and agarose gel electrophoresis.
Figure 3: Cryptosporidium parasite diagnostic wells (1-6) with molecular weight 320 pb.
Figure 4: The Phylogenetic tree plotted from the 18SrRNA gene of the Cryptosporidium spp. isolates (local Cryptosporidium species referred as red circular).
Table 3: Local gene sequences of Cryptosporidium in 12 positive reaction products of PCR technology
|
Name of isolate
|
Nucleotides size
|
GenBank number
|
Isolation repetitions (n)
|
|
Cryptosporidium ubiquitum strain RFMN1-2024
|
393 bp
|
PQ836187.1
|
1
|
|
Cryptosporidium parvum strain RFMN2-2024
|
350 bp
|
PQ836188.1
|
3
|
|
Cryptosporidium parvum strain RFMN3-2024
|
386 bp
|
PQ836189.1
|
3
|
|
Cryptosporidium hominis strain RFMN4-2024
|
380 bp
|
PQ836190.1
|
2
|
|
Cryptosporidium hominis strain RFMN5-2024
|
467 bp
|
PQ836191.1
|
2
|
|
Cryptosporidium ubiquitum strain RFMN6-2024
|
378 bp
|
PQ836192.1
|
1
|
Discussion
Results of present research recorded total rate of infection with Cryptosporidium spp. was 52% according the microscopical examination of sheep fecal samples which were obtained from various regions of Ninevah Governorate. Results are closely with previous studies in different cities in the world. The rate of infection was 3.8% in Turkey (25), and in Nigeria recorded rate 22.7% in sheep (26). In China recorded rates 1.8-6.8% in sheep farms (27). In Bangladesh recorded rate 11.3% (28), but in Iraq recorded high rate of infection with Cryptosporidium spp. oocysts 64.37% (56/87) (29) and rate 35.12% (22) were found in lambs in Mosul city. Out of one hundred examined sheep fecal samples, 51 (51%) were positive results to Cryptosporidium spp. in Al-Qadisiyah province (30). The cause of these variations in rats of infection belong to many components; such as amount of fecal sample, conditions for breeding, diagnostic procedure may which has significantly affected the infection rate. Widespread of Cryptosporidium in most regions of the world and in various hosts is due to the fact that oocysts of Cryptosporidium are passed on through directly contact with fecal infected persons (Transmission from person to person) or by fecal animals (zoonotic spread), as well as by the consuming of food contaminated (transmission of foodborne disease) and water contaminated (water-borne infection) (31,32).
Current study found the severity of infection with the Cryptosporidium spp. in sheep was 62.5%, however the rate of mild infection in sheep was 37.5%. This result was agreement with Hassan (22) who pointed out the percentage of lambs infected with severe infection was 36.11% while mild infection was 63.88% in lambs in Mosul city. The variation in infection rates may be due to several factors, including the number of animals examined, the examination method, the age of the animals, nutritional quality, animal immunity and the breeding system (30).
Results of Molecular examination revealed that all the samples (65 samples) which are sever infection based on microscopical examination, the results showed all samples were positive by PCR reaction based on 18S-ribosmal RNA gene (33). The findings indicate the detected of Cryptosporidium by PCR and identifying the species according sequence analysis, recorded 3 species of Cryptosporidium can be infected sheep C. parvum, C, hominis, C. ubiquitum. However, previous studies in Iraq (34) were identified 4 species C. parvum, C. hominis, C. ubiquitum and C. andersoni according to sequence examination of the heat shock protein 70 (Hsp70) in sheep of Babylon province, Iraq. Hussein and Khadim (23) isolated three species of Cryptosporidium there are C. hominis, C. parvum, and C. bovis from sheep in Wasit Province, Iraq.
Most scientific studies showed the high incidence of infection with C. parvum in contrast to other species of parasite could be explained that C. parvum is not specific to a host, and it is the most common species in other animals and the second common species in humans, behind C. hominis (35). By Gene sequencing recorded six new strains in Gen Bank and the reference squads to examine the levels of complete identity and overall score for similarity of the 18s ribosomal RNA gene of cryptosporidium spp. This was compared to other isolates and typically affected sheep. Local species Cryptosporidium that had been recorded in the GenBank database in named Cryptosporidium ubiquitum strain RFMN1-2024 in accession no. PQ836187.1were displayed as closed in relation to the reference. C. parvum isolates in named Cryptosporidium parvum strain RFMN2-2024 in accession no. PQ836188.1 the total percent identity score 41%. The strain under named Cryptosporidium parvum strain RFMN3-2024 in accession no. PQ836189.1 were showed closed related to strain in Japan at total percent identity score 45%. The strain Cryptosporidium hominis strain RFMN5-2024 in accession no. PQ836191.1 were showed closed related to strain in Chile at total percent identity score 53%. The study utilized the 18S rRNA gene for genetic investigation and phylogenetic evaluation the species of Cryptosporidium spp in Iraq (23,33). In Eastern region of Saudi Arabia (36,37). In Egypt (38). In Jordan (39). Future studies on Cryptosporidiosis in sheep should be focused on species which is a zoonotic aspect, aligning with previous studies (40).
Conclusion
This study demonstration the Cryptosporidium parasite in fecal samples of sheep by usig microscopical examination and conventional PCR in Mosul city, Iraq. The Microscopical examination of fecal samples for detection of Cryptosporidium should be accompanied by PCR and Gene sequences to get a precise diagnosis of infection with species of Cryptosporidium spp. based on fecal samples examination.
Acknowledgment
Authors show appreciation to University of Mosul College of Veterinary Medicine to supply the facilities.
Conflict of interest
Authors of this manuscript affirm that They don't have any conflicts of interest.