Introduction
Fallow deer (Dama dama) farming has recently become widespread in Mosul, both as ornamental animals and for food production, on account of elevation the nutritional value, protein content and depressed cholesterol levels, as well as its distinctive taste (1). Fallow deer breeding requires careful management to maintain their health and ensure a sustainable balance with their environment (2). Antibiotic resistance is constituting a great problem globally. Some bacteria as Escherichia coli, are considered as microbial indicators for the development of the prevalence of resistance to antibiotics between human, animals and environment therefor it is use to detect MDR in various animals as cattle, sheep and deer (3) E. coli is a commensal normal flora in digestive system of food producing animal which considered as a reservoir of bacteria that carries the antibiotics resistance genes (4). The randomly employ of antimicrobials in veterinary and human therapy is reflected the important agents in the selection of bacteria that resist to antibiotics may be readily transport between various strains by plasmids (5) in addition to repeatedly use of antibacterial drug in animal management practices with the aims of protection animals from diseases with enhancing the growth rates of animals (6). These practices contribute to increasing in spreading of antibacterial resistance bacteria including the ESBLs producing E. coli which constitutes a global challenge to confront this problem (5,7). Therefore, decreasing the use of antibacterial agents is very potent for prevention the spreading of the antibacterial resistance (8). ESBLs are enzymes that degenerate the beta-lactam antibiotics, mainly include cefotaximase (Ctx-M), sulfhydryl variable (SHV) and Temoneira (TEM) (9). Spreading resist strains of Escherichia coli within normal flora in intestinal tract, arise a potential risk to human validity due to the consuming contaminated foods especially meat and milk (10).
Many studies exist about ESBLs producing E. coli in food producing animals as chicken, sheep, fish and domestic animals as dogs especially in Mosul city (11-13), but there are no studies are available on wild animals as deer. Therefore, the objective of existing study to isolate the ESBL-resist E. coli from fallow deer and detect their ESBL genes.
Material and methods
Ethical approve
Every sample was taken in accordance with permission granted by an Institutional Animal Care and Use Committee, depending on the authority no UM.VET.2024.113.
Specimens
Fifty rectal swabs were obtained from diarrheic fallow deer of up to 6 months of age and both sexes. The samples collected from Fallow Deer Kingdom in Mosul city from the period of September 2024 to January 2025.The swabs were sent off immediately to the Lab of Microbiology
Bacterial isolation and identification
The rectal swabs were incubated at 37ºC for 24 hours in nutrient broth. A loopful of the broth that incubated were cultured on (MA+) (12). Then incubated at 37°C for 24 h. Suspected isolates were cultured on MA and EMBA for purification, bacterial Identification was performed through morphological and biochemical tests (14).
Extraction
For DNA extraction, all isolates were cultivated on (BHIA) at 37°C overnight. In accordance with the manufactured company (Adprep Genomic bacterial DNA Extraction, Korea), extraction was done for molecular confirmation of species and detection of some virulence genes. The DNA concentration was established using nanodrop (NanoPhotometer® N50/ Germany), and all DNA was stored in -80 ℃ until used (15).
Determination of bacteria and their virulence genes
For PCR amplification, the mixture 25µl (1 µl from forward and reverse primer, 10 µl of GoTaq® G2 Green Master Mix (Promega, USA), 8 µl of Danase-free water, and extracted DNA at 5 µl) were used to amplification uidA, CTX-M, SHV and TEM genes-specific for detection of E. coli and their virulence factor. All primer sequences and amplification cycles were listed in table 1 and 2, amplification was done by using conventional PCR (Sensoquest, Germany).
Table 1: Primers used
|
Primers
|
Sequence 5 - 3’
|
PCR product size
|
References
|
|
Udi A
|
Forward
|
CCAAAAGCCAGACAGAGT
|
623 bp
|
16
|
|
Reverse
|
GCACAGCACATCAAAGAG
|
|
CTX-M
|
Forward
|
CGCTTTGCGATGTGCAG
|
550 bp
|
|
Reverse
|
ACCGCGATATCGTTGGT
|
|
TEM
|
Forward
|
AAACGCTGGTGAAAGTA
|
720 bp
|
17
|
|
Reverse
|
AGCGATCTGTCTAT
|
|
SHV
|
Forward
|
ATGCGTTATATTCGCCTGTG
|
753bp
|
13
|
|
Reverse
|
TGCTTTGTTATTCGGGCCAA
|
Table 2: The amplification programs used for PCR and multiplex PCR
|
Type of PCR
|
Initial denaturation
|
Cycle numbers 35
|
Extension
|
|
Denaturation
|
Annealing
|
Extension
|
|
Udi A
|
95/3
|
95/1
|
57 /0.4
|
72/1
|
72/3
|
|
CTX-M
|
95/10
|
95/1
|
55 /1
|
72/1
|
72/5
|
|
TEM
|
94/5
|
94/0.3
|
45 /0.3
|
72/1
|
72/5
|
|
SHV
|
94/10
|
94/1
|
57/1
|
72/1
|
72/5
|
Results
According to the results of our investigation, the 82% of isolates were ESBL-resist E. coli that appear metallic sheen when growing on EMBA as illustrated in figure 1. The results of molecular confirmation, indicated that all PCR-subjected isolates were given a positive 623 bp amplicon for the uid A gene as shown as figure 2. Also, the molecular identification of CTX-M and TEM genes for E. coli confirmed that an amplicon product 550 bp and 720 bp respectively were obtained as in figures 3 and 4. While all isolate gave negative results for SHV-gene.
Figure 1: Eosin methylene blue agar shows metallic sheen phenomena of E. coli.
Figure 2: PCR amplicons for uidA genes. M: 100 bp marker, 1-8: E. coli isolates, NC: Negative control.
Figure 3: PCR amplicons for CTX-M A genes. M: 100 bp marker, 1-8: E. coli isolates, NC: Negative control.
Figure 4: PCR amplicons for TEM genes. M: 100 bp marker, 1-8: E. coli isolates, NC: Negative control.
Discussion
β-lactam antibiotics have been used successfully to treat infections induced on by infectious Escherichia coli. E. coli strains from various pathotypes have evolved to be a critical public validity concern. However, the activity of β-lactams is currently being severely undermined by numerous hydrolytic enzymes, known as β-lactamases, produced by bacteria (18). The current study results detected that the 82% of isolates were resist to cefotaxime when growing on (MA+) medium that belonging to ESBLs which recorded 33% and 54% producing E. coli isolated from deer (19,20). The 87.5% of E. coli. strains were resisted to ESBL antibiotics (21). Difference in isolation percentage suggests that deer are not being bred hygienically and that E. coli is acting opportunistically (18). Additionally, these bacteria have a variety of virulence factors mainly ESBLs enzyme (19). Others factors, including immunity status and nutritional conditions of fallow deer (22), as well as the variation in the geographic distribution (23). According to the molecular detection, the results showed all isolates had the TEM and CTX-M genes, both genes in E. coli resist ESBL (24), while only CTX-M genes and others recorded only TEM genes of ESBLs producing E. coli in deer (25). Also, current study showed that all isolate were negative to SHV gene. The discrepancy in results is explained by the beta-lactamases of the CTX-M and TEM types are most commonly identified in E. coli especially in deer (23,26), in addition to antimicrobials are extensively employed in the farms of animals aimed at disease treatment and prevention, animal growth promotion(27,28),the overuse of antimicrobials leads to spreading of antibacterial resistance bacteria in their surroundings due to west animals (22) also incrase the Antibiotic residues in milk and meat. which induces resistance in bacteria present in the environment through mutation (29-31). It thereby provides selective pressure for those antibiotic-resistant bacterial species to survive in the environment where that antibiotic is present (32,33).
The resistance for ESBL antibiotics has become an important public validity concern resulting from their rapid dissemination among commensal and pathogenic E. coli (33,34). The existence of ESBL resist E. coli in deer suggests possible potential contamination with cross-species transmission, potentially linked to agricultural runoff, human waste, or interaction with livestock (35). The upsurge incidence of strains the beta-lactamase-producing E. coli, poses a significant challenge to treatment and highlights the critical requirement for effective antimicrobial stewardship with the establishment of unique therapeutic strategies (36).
Conclusion
In the present investigation, ESBLs -producing E. coli that carried the TEM and CTX-M genes were found in Fallow deer. Fallow deer is representing as significant source of distribution of ESBLs producing E. coli to other animals, human and environment.
Acknowledgments
None.
Conflict of interest
None.
|
- Polak T, Rajar A, Gašperlin L, Žlender B. Cholesterol concentration and fatty acid profile of red deer (Cervus elaphus) meat. Meat Sci. 2008;80:864–869. DOI: 1016/j.meatsci.2008.04.005
- Kunová S, Sendra E, Hašˇcík P, Vukovi NL, Vuki´c MD, Hsouna AB, Mnif W, Kaˇcániová M. Microbiological Quality of Deer Meat Treated with Essential Oil Litsea cubeba. 2022;12:2315. DOI: 10.3390/ani12182315
- Alonso CA, González-Barrio D, Tenorio C, Ruiz-Fons F, Torres C. Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multi resistant coli producing extended-spectrum beta-lactamase. Comp Immunol Microbiol Infect Dis. 2016;45:34-9. DOI: 10.1016/j.cimid.2016.02.003
- Ikushima S, Torii H, Sugiyama M, Asai T. Characterization of quinolone-resistant and extended-spectrum β-lactamase-producing Escherichia coli derived from sika deer populations of the Nara Prefecture, Japan. J Vet Med Sci. 2023;85(9):937–941. DOI: 1292/jvms.23-0069
- Elsby DT, Zadoks RN, Boyd K, Silva N, Chase-Topping M, Mitchel MC, Currie C, Taggart MA. Antimicrobial resistant Escherichia coli in Scottish wild deer: Prevalence and risk factors. Environ Pollut. 2022;314:120129. DOI: 1016/j.envpol.2022.120129
- Vinué L, Sáenz Y, Martínez S, Somalo S, Moreno MA, Torres C, Zarazaga M. Prevalence and diversity of extended-spectrum beta-lactamases in faecal Escherichia coli isolates from healthy humans in Spain. Clin Microbiol Infect. 2009;15(10):954-7. DOI: 1111/j.1469-0691.2009.02803.x
- Dahms C, Hübner NO, Kossow A, Mellmann A, Dittmann K, Kramer A. Occurrence of ESBL-Producing Escherichia coli in Livestock and Farm Workers in Mecklenburg-Western Pomerania, Germany. PLoS One. 2015;25:1-13. DOI: 1371/journal.pone.0143326
- Tamamura-Andoh Y, Tanaka N, Sato K, Mizuno Y, Arai N, Yanai AW, Akiba M, Kusumoto M. A survey of antimicrobial resistance in Escherichia coli isolated from wild sika deer (Cervus nippon) in Japan. J Vet Med Sci. 2021;83(5):754–758. DOI: 1292/jvms.21-0005
- Riaz A, Shahzad MA, Ahsan A, Aslam R, Usman M, Rasheed B, Hussain M, Irtash M, Saleemi MK, Ali A, Sajid SM, Irshad H. Investigations into the Role of Zoo Animals in Transmitting the Extended Spectrum Beta Lactamases (ESBL) coli in the Environment. Int J Vet Sci. 2023;12(6):832-837. DOI: 10.47278/journal.ijvs/2023.046
- Guber AK, Fry J, Ives RL, Rose JB. Escherichia coli Survival in, and Release from, White-Tailed Deer Feces. Appl Environ Microbiol. 2015;81(3):1168–1176. DOI: 1128/AEM.03295-14
- Ullah A, Jafar S, Rauf M, Rauf M, Fahad MSS, Junaid M. Isolation and identification of extended spectrum Β-Lactamase coli from retail chicken meat and the effect of azadirachta indica (Neem) plant on them. Am J Clini Microbiol Antimicrob. 2021;4(1):1051. [available at]
- Widodo1 A, Khairullah AR, Effendi MH, Moses IB, Agustin AD. Extended-spectrum β-lactamase-producing Escherichia coli from poultry: A review. Vet World. 2024;17(9):2017–2027. DOI: 14202/vetworld.2024.2017-2027
- Saeed NM. Detection of Extended Spectrum Beta-lactamase gene production by coli isolated from human and broiler in Sulemania province/ Iraq. Sulaimani J Pure Appl Sci. 2014;16(2):97-102. [available at]
- Chess B. Talaro՚s Foundations in Microbiology. 12th USA: McGraw Hill LLC; 2024. 548 p.
- Tille PM. Bailey & Scott՚s Diagnostic Microbiology. 15th Canada: Elsevier; 2022. 139 p.
- Langkabel N, Burgard J, Freter S, Fries R, Meemken D, Ellerbroek L. Detection of Extended-Spectrum β-Lactamase (ESBL) coli at Different Processing Stages in Three Broiler Abattoirs. Microorganisms. 2023;11(10):2541. DOI: 10.3390/microorganisms11102541
- Ali T, Zhang L, Shahid M, Zhang S, Liu G, Gao J, Han B. ESBL producing Escherichia coli from cows suffering mastitis in China contain clinical class 1 integrons with CTX-M linked to ISCR1. Front Microbiol. 2016;7:1931. DOI: 3389/fmicb.2016.01931
- Villa AY, Flores RM, Aparicio ED, Casas EC, Espinosa RM, Delgado G, Navarro A, Escalante SA, Cortes JX, Romero FA, Castro RH. Escherichia coli virulence genes and clonality in strains from diarrhoea in goat kids. Small Rum Res. 2023;220:106906. DOI: 1016/j.smallrumres.2023.106906
- Ikushima S, Sugiyama M, Asai T. Molecular characteristics of CTX-M β-lactamase-producing and quinolone-resistant Escherichia coli among deer in a popular tourist spot in Japan. Access Microbiol. 2024;6(11):000882.v3. DOI: 1099/acmi.0.000882.v3
- Srisrattakarn A, Saiboonjan B, Tippayawat P, Angkititrakul S, Chanawong A, Pornchoo C, Smithkittipol C, Lulitanond A. CTX-M, SHV, TEM and VEB β-lactamases, and MCR-1 among multidrug-resistant Escherichia coli and Klebsiella isolates from environment near animal farms in Thailand. J Infect Pub Health. 2025;18(2):102624. DOI: 1016/j.jiph.2024.102624
- Ikushima S, Torii H, Sugiyama M, Asai T. Characterization of quinolone-resistant and extended-spectrum β-lactamase-producing Escherichia coli derived from sika deer populations of the Nara Prefecture, Japan. J Vet Med Sci. 2023;85(9):937–941. DOI: 1292/jvms.23-0069
- Jan VM, Juan José RA, Juan Antonio M, Jesús G, Susana RJ, Joaquín P, José Y. The fallow deer Dama celiae nov. with two-pointed antlers from the Middle Pleistocene of Madrid, a contemporary of humans with Acheulean technology. Archaeol Anthropol Sci. 2023;15(4). DOI: 10.1007/s12520-023-01734-3
- Castanheira M. Extended-spectrum β-lactamases: An update on their characteristics, epidemiology and detection. J Antimicrob Chemother. 2021;3(3):dlab092. DOI: 1093/jacamr/dlab092
- Riwu KP, Effendi MH, Rantam FA, Khairullah AR, Kurniawan SC, Kurniawan A, Moses IB, Hasib A, Widodo A, Yanestria SM, Silaen OM, Shehzad A. Molecular detection of blaTEM gene for encoding extended spectrum beta-lactamase (ESBL) on Escherichia coli isolated from deer feces in Indonesia. J Adv Vet Res. 2024;14(4):722-726. [available at]
- Bachmann TH, Schütz AK, Dreyer S, Glanz J, Schaufler K, Conraths FJ. Genomic Analysis of ESBL-Producing coli in Wildlife from North-Eastern Germany. Antibiot. 2022;11(2):123. DOI: 10.3390/antibiotics11020123
- Cooksey R, Swenson J, Clark N, Gay E, Thornsberry C. Patterns and mechanisms of beta-lactam resistance among isolates of Escherichia coli from hospitals in the United States. Antimicrob Agent Chemother. 1990;34(5):739–45. DOI: 1128/AAC.34.5.739
- Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, Teillant A, Laxminarayan R. Global trends in antimicrobial use in food animals. Proc Natl Acad Sci. 2015;112:5649-5654. DOI: 1073/pnas.1503141112
- Menkem ZE, Ngangom BL, Tamunjoh SA, Boyom FF. Antibiotic residues in food animals: Public health concern. Acta Ecol Sin. 2019;39:411-415. DOI: 1016/j.chnaes.2018.10.004
- Ribeiro LF, Nespolo NM, Rossi GA, Fairbrothe JM. Exploring Extended-spectrum beta-lactamase (ESBL) producing Escherichia coli in food-producing animals and animal-derived foods. Pathogens 2024;13:346.2-11. DOI: 3390/pathogens13040346
- Bartkiene E, Ruzauskas M, Bartkevics V, Pugajeva I, Zavistanaviciute P, Starkute V, Zokaityte E, Lele V, Dauksiene A, Grashorn M, Hoelzle LE, Mendybayeva A, Ryshyanova R, Gruzauskas R. Study of the antibiotic residues in poultry meat in some of the EU countries and selection of the best compositions of lactic acid bacteria and essential oils against Salmonella enterica. Poult Sci. 2020;99:4065-4076. DOI: 1016/j.psj.2020.05.002
- Muaz K, Riaz M, Akhtar S, Park S, Ismail A. Antibiotic residues in chicken meat: Global prevalence, threats, and decontamination strategies: A review. J Food Prot. 2018;81:619-627. DOI: 4315/0362-028X.JFP-17-086
- Stephan R, Hachler H. Discovery of extended-spectrum β-lactamase producing Escherichia coli among hunted deer, chamois and ibex. Schweiz Arch Tierheilkd. 2012;154(11):475-8. DOI: 1024/0036-7281/a000390
- Mann A, Nehra K, Rana JS, Dahiya T. Antibiotic resistance in agriculture: Perspectives on upcoming strategies to overcome upsurge in resistance. Curr Res Microbiol Sci. 2021;2:100030. DOI: 1016/j.crmicr.2021.100030
- Polianciuc SI, Gurzău AE, Kiss B, Ştefan MG, Loghin F. Antibiotics in the environment: Causes and consequences. Med Pharm Rep. 2020;93:231-240. DOI: 15386/mpr-1742
- Mulchandani R, Wang Y, Gilbert M, Van Boeckel TP. Global trends in antimicrobial use in food-producing animals: 2020 to 2030. PLoS Glob Pub Health. 2023;3:e0001305. DOI: 1371/journal.pgph.0001305
- Ramos S, Silva V, Dapkevicius ME, Caniça M, Tejedor-Junco MT, Igrejas G, Poeta P. Escherichia coli as commensal and pathogenic bacteria among food-producing animals: Health implications of extended spectrum ß-lactamase (ESBL) production. Anim. 2020;10:2239. DOI: 3390/ani10122239
|