Introduction
Oral Candidiasis (thrush) in chickens is one of the ecumenical infections that effects on poultry industry. Chickens, turkeys, geese, and parakeets are considered highly susceptible hosts to infection with this form of candidiasis (1). Candida albicans is a part of the flora in the oral cavity of the chicken, that is commensals on the mucocutaneous cells in the gastrointestinal tract of chicken (2,3) it is an opportunistic pathogen and causes thrush when the predisposing factors to infection are available as immunosuppressive conditions e.g. debilitation, malnutrition, overcrowding, poor hygiene, young chicken less than 4 weeks and concurrent disease (4). Also, when using the long-term therapy of antimicrobial drugs (5). The main sources for candidiasis are contaminated food or drinking water with C. albicans from the environments e.g. human waste, and droppings of birds (6,7). C. albicans causes types of inflammation in the mouth, esophageal, gizzard, and crop due to its possessing virulence genes, which permit them to invade the host tissue and avoidance of defense mechanisms (8) as extracellular enzymes, including phospholipases, aspartyl proteases that contribute in adhesion to the epithelium cell, degrade proteins of the extracellular matrix (9,10).In addition, virulence factors of C. albicans are very linked with the nature of pathogens as adherence and coaggregation, phenotype switching, interference with the immune system as immunomodulation, and antibiotic resistance (11,12). In the ALS (Agglutinin-Like Sequence) gene family, the agglutinin-like sequence is an important family related to adhesions in C. albicans (13,14). The members of this family interact with several substrates, including the epithelial cells of the host besides proteins (15,16). Hyphal wall protein 1 (HWP1) another adhesion gene, is regulated at the time of the development of biofilm. HWP1, glycosylphosphatidylinositol (GPI) linked mannoprotein. It is a substrate for transglutaminase activity acquired from a host; thus, it moderates the covalent affinity of C. albicans with the host cells (17). C. albicans is a Gram-positive microorganism, a polymorphic yeast that reproduces by budding and chlamydospores and forms pseudohyphae (18,19). These features depend on the diagnosis, besides the formation of a germ tube in serum through 2h at 37℃ (20). Molecular diagnosis is important for confirming isolates and detecting the genes that contribute to their virulence (21).
Previous genetic studies of C. albicans have detected that virulence factors might be correlated with the genotypic profiles. The molecular diagnosis that is more sensitive and specific therefore has been used for these analyses (10), therefore, this study aimed to detect C. albicans molecularly and their Adhesion genes as ALS1, and HWP1.
Material and methods
Ethical statement
The Institutional Animal Care and Use Committee (UM.VET.2024.104) 18/8/2024 licensed this study.
Isolates
Eighteen isolates of C. albicans, previously isolated from chickens with oral candidiasis in a study conducted at the College of Veterinary Medicine, University of Mosul, were examined in this research. Methods used for isolation and diagnosis of C. albicans were mentioned in the study (1). The isolates were enhanced on Brain Heart Infusion agar at 37°C for 18h. and subculture on Sabouraud Dextrose agar at 37°C for 48 h. Then, isolates were confirmed by culturing them on Candida Chromogenic agar (CONDA com, Spain).
Germ tube formation
A germ tube formation test was used to distinguish C. albicans from other species, by injecting a one colony of suspected isolates in 0.5 ml of human serum and incubating at 37°C /3 h. (22).
DNA Extraction
All C. albicans isolates were subjected to DNA extraction for molecular conformation and detection of ALS1 and HWP1genes, the extraction of DNA was done by using Add Prep Genomic DNA Extraction (Korea) according to the company's instructions, and the DNA concentration was determined using Nanodrop (Nano Photometer® N50/ Germany). The DNA stored in -80 ℃ until used. The 25μl of PCR mixture (1 μl from each primer, 10 μl of GoTaq® G2 Green Master Mix (Promega, USA), 8 μl of DNase-free water, and 5μl of extracted DNA) was used for amplification 18S rRNA gene specific for the detection of C. albicans, ALS1, and HWP1. All primer sequences and amplification cycles (Tables 1 and 2), and amplification was done by using conventional PCR (Sensoquest, Germany) (23,24).
Table 1: Amplification program for genes under study
|
Type of PCR
|
Initial denaturation
|
Cycle numbers 35
|
Final extension
|
|
Denaturation
|
Annealing
|
Extension
|
|
18S rRNA
|
95/2
|
94/0.30
|
59 /0.30
|
72/1
|
72/5
|
|
ALS1
|
95/2
|
94/0.30
|
58 /0.30
|
72/1
|
72/5
|
|
HWP1
|
95/2
|
94/0.30
|
59 /0.30
|
72/1
|
72/5
|
Data expressed as ºC/minutes.
Table 2: The primer sequences for genes under the study
|
Gene primer
|
Sequence (5’ – 3’)
|
Products size
|
References
|
|
18S rRNA
|
F-GCCGCCAGAGGTCTAAACTT
R- AGTTCAGCGGGTAGTCCTAC
|
415 bp
|
(25)
|
|
ALS1
|
F-ACATGTACTGTTGAACGACGCT
R-GACGACTGCCAGCACAAGTA
|
577 bp
|
(26)
|
|
HWP1
|
F-TCTACTGCTCCAGCCACTGA
R-TTCAGTGGCAGGACTGATG
|
501 bp
|
(27)
|
Sequencing of Candida albicans isolates
After the PCR amplification, the amplicons were sequenced (Macrogen, Korea). Using BLAST, the obtained gene sequences were compared with Partial DNA sequences of the agglutinin-like protein (ALS1) gene sequences from other countries that had already been recorded in the GenBank. The phylogenetic tree of C. albicans isolated from local chickens in Iraq was organized to utilize the Maximum Likelihood technique based on the Tamura-Nei model in MEGA11 software (28,29).
Results
Germ tube formation:
According to the formation of the germ tube, the results revealed that all isolates formed the germ tube after 2-3 h on incubation on human serum at 37℃ (Figure 1). On Candida Chromogenic agar, all C. albicans isolates showed green colonies (Figure 2).
Figure 1: Producing germ tube from C. albicans.
Figure 2: C. albicans produces green colonies on Candida chromogenic agar.
Molecular detection of Candida albicans and their virulence genes
The molecular identification of 18S rRNA for C. albicans gave an amplicon product of 416 bp (Figure 3). The amplification of ALS1 virulence genes resulted in 577 bp in 66% of C. albicans isolates (Figure 4). In contrast, the amplification of the HWP1 gene yielded negative results for all tested C. albicans isolates.
Figure 3: Amplification of the 18S rRNA gene for C. albicans M= 100 bp. marker, 1-6 =positive isolates, Nc= negative control.
Figure 4: Amplification of the ALS1 gene for C. albicans M= 100 bp. marker. (1-6) positive isolates, Nc= negative control.
Sequencing and phylogenetic tree
The genetic sequence of the isolates was determined, then the query alignment of C. albicans with the NCBI GenBank was determined, and its percentage of identity with global isolates was determined (Figure 5). Four isolates of Candida albicans were registered in the NCBI with serial numbers PO328951, PQ328952, PQ328953, and PQ328954. The isolates showed a 97-100% affinity with global isolates in China, USA, and India (Table 3). The phylogenetic tree of C. albicans isolated in Iraq and the degree of relatedness with global isolates were determined (Figure 6).
Figure 5: The identification of query C. albicans alignment with NCBI GenBank
Table 3: Distribution of C. albicans according to NBLAST in GenBank
Figure 6: Phylogenetic tree of Candida albicans from Iraq (Red color). The phylogenic tree was constructed using the Maximum Likelihood method based on the Tamura-Nei model in MEGA11 software and bootstrap analysis with 1000 re-samplings. Partial DNA sequences of the gene ASL1 were used as input data.
Discussion
Candida albicans is an opportunistic pathogen that causes superficial and systemic mycoses in animals, including poultry (30,31). Excessive and incorrect use of medications, hormones, and immunosuppressants in the last few years, in addition to contamination of feed, has led to an increase in the thrush rate in animals and humans (32,33). All isolates used in this study were confirmed in chromogenic agar gave a green color this result is in agreement with (34,35). The germ tube formation test is a rapid and reliable method for diagnosing C. albicans. This test is highly specific for C. albicans, with a specificity of approximately 99% (36).
Many studies have focused on the molecular aspect of Candida isolated from humans and rarely considered isolates taken from animals, including birds, where it is necessary to focus on distribution and genetic diagnosis to know the epidemiology (37-39). When using molecular detection of the isolates under study, all isolates showed amplification of the (18S rRNA gene) with a molecular weight of 415 bp, which is consistent with (26,33). The molecular investigation used provided more sensitive and specific results (10).
- albicans possesses several virulence factors that aid in adhesion and invasion of the host tissue (40). The results showed the presence of the ALS1 gene at a rate of 66%, as many studies have shown its presence at a similar percentage (21,31), the ALS genes are the largest family responsible for adhesion, as they include a group of genes that interact with the host cells to enable them to anchor and stabilize (41,42).
Hyphal cells play a fundamental role in the growth and spread of Candida, as they invade cells and also damage the tissues. The genes responsible for the production of hyphae are HWP1, ALS1, and HGC1 (43,44). The current study showed that all tested C. albicans isolates did not contain the HWP1 gene; this result may be due to the limited number of isolates studied and the methods used (17). This gene is also associated with adhesion, and regulated during biofilm formation (10,45), this result is similar to many studies that showed that at least 195 isolates were negative out of 206 isolates for this gene (21). Earlier studies have revealed that HWP1 is not expressed during the growth phase of yeast but is highly expressed in hyphal form and germ tube (46). The defects of biofilm formation that are associated with the HWP1 mutant in vitro and in vivo are completely in agreement with the idea that expression of HWP1 is specific in hyphae related to biofilm formation (47). Some studies emphasized that C. albicans isolated from birds have already been reported in human infections and that these birds and chickens could be considered sources of infection for other animals, and for people as farmers and veterinarians (48).
Conclusion
- albicans possesses the ALS1 gene, which is found in a high ratio in the isolates under study, and the ALS genes are the largest family responsible for adhesion, interaction with the host cells to enable them to colonize and stabilize, in the outcome participate in the pathogenicity of this yeast. While the tested C. albicans isolates did not contain the HWP1 gene.
Conflict of interest
The authors declare that there is no conflict of interest.
Acknowledgements
The authors would like to thankfulness to the College of Veterinary Medicine, University of Mosul, Iraq.