Introduction
Piroplasmid parasites, primarily represented by the genera Babesia and Theileria, are obligate intraerythrocytic protozoa transmitted by ixodid ticks and pose major challenges to animal health and livestock production worldwide (1-5). These parasites can cause a range of clinical manifestations, from subclinical to severe disease, characterized by anemia, fever, jaundice, weight loss, and death in some cases (6-11). Moreover, subclinical disease may reduce productivity and act as a reservoir for tick-borne transmission (12). Babesia and Theileria species are primarily transmitted by ixodid ticks and infect a wide range of domestic and wild animals, including goats (6-8,10). Molecular diagnostic methods have proven to be highly sensitive and specific tools for detecting and identifying piroplasmid parasites in both host and vector populations. These methods enable the detection of low-level parasitemia and mixed infections that may be ignored by traditional microscopic techniques (13,14). So, the molecular tools have facilitated the discovery of new Theileria and Babesia species (15-18). Molecular recognition targeting tick vectors provides valuable insights into parasite epidemiology, transmission dynamics, and infection risks in host populations (19,20). The coexistence of competent tick vectors and susceptible hosts creates a favorable environment for the maintenance and spread of piroplasmid parasite infections (21). Goats are extensively reared in the Mediterranean region of Türkiye, where the climate is highly conducive to the survival and proliferation of ixodid ticks. Several studies have investigated piroplasm parasites in small ruminants and their vectors in Türkiye (2,19); however, data on the distribution and frequency of these parasites in this region remain limited.
The present study aimed to detect piroplasmid parasites in ticks that infest goats in the Mediterranean region of Türkiye. These findings enhance our understanding of the local epidemiological parameters of Theileria and Babesia infections.
Materials and Methods
Study area, collection of ticks, and forming tick pools
Ethical statement: Ethical approval for this study was granted by the Animal Experiments Local Ethics Committee of the Elazığ Veterinary Control Institute (Document no. 2018/02). Study area: This molecular survey was conducted between May and September 2018 in domestic goats from the provinces of Antalya (36° 53′ N, 30° 42′ E) and Mersin (36° 47′ N, 34° 37′ E) in the Mediterranean region of Türkiye. The region is characterized by a Mediterranean climate, with hot and humid summers and mild, precipitation-rich winters, which may influence the ecology and seasonal activity patterns of vector species. During winter, goats are kept indoors in coastal villages; in spring, they migrate to graze in the Taurus Mountains until autumn. A total of 293 goats, randomly selected from 24 herds across 19 villages, were examined for tick infestation. Collection of ticks: A total of 1,091 adult ticks belonging to 3 genera and 5 species (Rhipicephalus bursa, R. turanicus, R. sanguineus, Hyalomma marginatum, Dermacentor raskamensis) were collected from 194 infested goats. Detailed information on tick load per goat, attachment sites, and tick species distribution has been previously published (22). Forming tick pools: From 1,091 ticks, 661 specimens were grouped into 127 pools (1-14 ticks per pool) based on species, geographic origin (province/district/village), gender, and engorgement level. PCR amplification may be inhibited in engorged adult ticks due to the higher host blood content, which can interfere with reaction efficiency. To reduce host DNA interference in PCR assays, ticks with low blood volume were selected.
DNA extraction
Before DNA extraction, the external surfaces of the ticks were disinfected using 70% ethanol, followed by three rinses with sterile water, and then dried on filter paper. The sterilized ticks were stored at -80°C overnight to facilitate tissue homogenization. For DNA isolation, the frozen ticks were homogenized in the same tubes using a sterile, disposable pestle with the aid of liquid nitrogen (20,23). DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s standard protocol. After extraction, the samples were stored at 4°C until processing for molecular analyses. DNA from B. ovis and T. ovis-infected R. bursa were used as positive controls.
Polymerase chain reaction and agarose gel electrophoresis
DNA samples from tick pools were first screened using a nested PCR targeting the 18S rRNA gene of all piroplasm species. First-round PCR was performed with primers Nbab1F and Nbab1R (24), followed by second-round PCR using RLB-F2 and RLB-R2 primers (25). The primers were obtained from BM Labosis (Ankara, Türkiye). Positive pools were subjected to species-specific PCRs targeting partial 18S rRNA regions of B. ovis (26), B. aktasi (27), and T. ovis (28). The primers (primer sequence 5'-3’, product size (base pair) applied in the current study are presented in Table 1. PCR was performed in a final volume of 25 µL, comprising 12.5 µL of 2× PCR Master Mix (Thermo Scientific), 1 µL of each primer (10 pmol/µL), 2 µL of extracted DNA, and 8.5 µL of ultra-pure water. One μL of the amplicon from the first-round PCR was used as the template in the second-round PCR. The touchdown PCR procedure and thermal cycling conditions were carried out as previously reported (20). Briefly, the cycling conditions were denaturation at 94°C for 5 min, followed by 94°C for 20 s, 67°C for 20 s, and 72°C for 30 s. The annealing temperature was decreased by 2°C every second cycle to a “touchdown” temperature of 57 °C. Reactions were run on a thermal cycler (Labcycler Gradient, Göttingen, Germany). The amplified DNA fragments were electrophoresed on 1.5% agarose gels and subsequently visualized under ultraviolet illumination. DNA ladder (100 bp) served as a molecular weight reference. Each PCR assay included previously confirmed genomic DNA from B. aktasi, B. ovis, and T. ovis as positive controls, along with a negative control containing nuclease-free water.
Table 1: The primer (primer sequence 5'-3’, amplicon size) applied in this study
|
Marker (18S rRNA)
|
Primer
|
Primer sequence 5'-3’
|
Amplicon size (bp)
|
Reference
|
|
Theileria/Babesia
(First-round PCR)
|
Nbab1F
Nbab1R
|
AAGCCATGCATGTCTAAGTATAAGCTTTT
CCTCTCCTTCCTTTAAGTGATAAGGTTCAC
|
1600
|
24
|
|
Theileria/Babesia (Nested PCR)
|
RLBF2
RLBR2
|
GACACAGGGAGGTAGTGACAAG
CTAAGAATTTCACCTCTGACAGT
|
360-430
|
25
|
|
Babesia ovis
|
Bbo-F
Bbo-R
|
TGGGCAGGACCTTGGTTCTTCT
CCGCGTAGCGCCGGCTAAATA
|
549
|
26
|
|
Babesia aktasi
|
Ba600F
Ba1019R1
|
GAATCGACGTTCGTCGTTTA
GTTTCAGCCTTGCGACCATACT
|
438
|
27
|
|
Theileria ovis
|
TSsr 170F
TSsr 670R
|
TCGAGACCTTCGGGT
TCCGGACATTGTAAAACAAA
|
520
|
28
|
Infection rates in pooled ticks
The Maximum Likelihood Estimation (MLE) approach was applied to estimate infection rates in pooled ticks with variable sizes, and corresponding 95% confidence intervals (CI; lower and upper bounds) were computed. The analyses were performed using the PooledInfRate software, implemented as a Microsoft Excel add-in, as described previously (2,20,29,30).
Results
Prevalence rate of caprine tick-borne piroplasmid parasites
A total of 127 tick pools, representing 661 individual ticks from 5 ixodid species, were analyzed by PCR. 37 pools (29.13%) tested positive for Babesia ovis and/or Theileria ovis. The most commonly detected parasite in the tick pools was B. ovis, followed by T. ovis. In contrast, no B. aktasi DNA was identified in any of the pooled ticks. Table 2 shows the number of examined tick pools and infection rates for piroplasmid parasites.
The MLE infection rate was 67.15% per 1,000 ticks. Infection rates varied by tick species, ranging from 0.03% in D. raskamensis to 71.70% in R. bursa. No infections were detected in R. sanguineus. Twenty-seven pools (21.25%) tested positive for B. ovis, corresponding to an MLE of 46.86%, with involvement of R. bursa, R. turanicus, and H. marginatum. Theileria ovis was detected in 7 pools (5.51%) from R. bursa, R. turanicus, and D. raskamensis, with an MLE of 7.67%. Single B. ovis infections were detected in R. bursa (24/85) with an MLE of 53.23%, in R. turanicus (2/17) at an MLE of 34.45%, and in H. marginatum (1/8) at an MLE of 58.25%. Theileria ovis infections were identified in R. bursa (5/85) with an MLE of 9.23%, in R. turanicus (1/17) at an MLE of 15.48%, and in D. raskamensis with an MLE of 0.03%. Small ruminant piroplasm DNA was not detected in R. sanguineus. The majority of tick pools were positive for a single pathogen (B. ovis or T. ovis). However, mixed infections with both parasites were observed in 3 pools (2.36%) from R. bursa, with an MLE of 4.58%.
Table 2: Infection rates of goats with piroplasmid parasites in ixodid ticks that infest the goats
|
Tick species
|
NET/NEP
|
NPP
|
MLE (%)
|
Single infection
|
B. ovis with
T. ovis
|
|
B. ovis
|
B. aktasi
|
T. ovis
|
|
R. bursa
|
550/85
|
32 (37.64%)
|
71.70
|
24/85 (53.23) a
|
-
|
5/85 (9.23)
|
3/85 (5.50)
|
|
R. turanicus
|
62/17
|
3 (17.64%)
|
51.78
|
2/17 (34.45)
|
-
|
1/17 (15.48)
|
-
|
|
R. sanguineus
|
2/2
|
-
|
-
|
-
|
-
|
-
|
-
|
|
H. marginatum
|
16/8
|
1 (12.5%)
|
58.25
|
1/8 (58.25)
|
-
|
-
|
-
|
|
D. raskamensis
|
31/15
|
1 (6.66%)
|
0.03
|
-
|
-
|
1 (0.03)
|
-
|
|
Total
|
661/127
|
37 (29.13%)
|
67.15
|
27/127 (46.86)
|
-
|
7/127 (7.67)
|
3/127 (4.58)
|
NET; number of examined ticks, NAP; number of examined pools, NPP; number of positive pools; CI, Coinfidence Intervals; aThe rate (…%) shows the MLE result.
Discussion
Piroplasms are apicomplexan parasites transmitted by hard ticks and distributed globally. They are responsible for piroplasmosis, including theileriosis and babesiosis in vertebrates, making them important from both medical and economic perspectives (31-33). This molecular recognition provides significant insights into the epidemiology of small ruminant babesiosis and theileriosis in Türkiye’s Mediterranean region. The overall prevalence of piroplasmid parasites in hard ticks was 67.15% in the current study. In other regions, reported prevalence rates include 14% in Iran (34), 10% in the United Arab Emirates (35), 43% in Egypt (36), 3.49% in China (37), 5.4% in Palestine (38). Compared with these reports, the prevalence found in the present study is higher than that reported in other countries. It is well known that the distribution patterns of ixodid ticks and the transmission of tick-borne diseases are shaped by climatic factors such as rainfall, vegetation, altitude, and temperature, as well as by host availability (39). Pooling is an essential approach for screening large numbers of tick samples for pathogens, as it significantly reduces the resources and time required for molecular screening. However, this method has the drawback of reduced resolution, particularly when estimating individual infection rates. To balance efficiency and statistical accuracy, we limited each pool to 14 ticks. We also applied maximum likelihood estimation (MLE) to adjust for potential biases arising from differing pool sizes, thereby providing more accurate estimates of infection prevalence (2,20,29,30). In this study, the detection of piroplasm parasites (B. ovis and/or T. ovis) in tick pools underscores the considerable infection pressure on small ruminant populations in the sampled region, as evidenced by the number of infected ticks per 1,000 examined. The predominance of R. bursa as a carrier of both parasites in the current study is consistent with its recognised role as the principal vector of B. ovis and T. ovis (20, 40-43). Despite being lower than in R. bursa, the estimated piroplasm infection rate in R. turanicus is noteworthy, supporting previous findings that this tick species may serve as a potential vector for both parasites (44-46).
Babesia ovis is the most pathogenic piroplasmic parasite infecting small ruminants. Due to the presence of suitable climates and habitats in many regions of Türkiye, including the Mediterranean region, there is a broad diversity of tick species and piroplasm parasites in the country (19,20). In our previous tick survey (20), T. ovis was the most frequently detected pathogen, with an MLE of 1.38% (29 positive pools out of 310). This was followed by B. ovis, which was found in 20 out of 310 tick pools, corresponding to a MLE of 0.92%. The prevalence of T. ovis in hard ticks from Southern Iran (34) and Palestine (38) is comparable to our findings. In a recent study conducted in the United Arab Emirates (35), molecular analyses showed that H. anatolicum collected from goats were positive for T. ovis (10%). In this study, the detection of B. ovis and T. ovis in R. bursa, R. turanicus, and H. marginatum is consistent with previous studies from different regions of Tüekiye (20,40,44). However, this is the first time T. ovis has been detected in D. raskamensis in Türkiye. Interestingly, in a previous study conducted in the same region on sheep and goats, B. aktasi was identified as the most prevalent piroplasm species infecting goats (47). However, in the present tick survey from the same geographical area, B. aktasi DNA was not detected in any of the examined tick pools. This discrepancy suggests that the absence of B. aktasi in the tick populations may indicate that the primary vector(s) responsible for its transmission were not captured during our sampling.
Since certain tick species, such as R. bursa, can act as vectors for multiple piroplasm species simultaneously, mixed infections caused by piroplasm parasites are frequently detected in ticks. Small-ruminant Babesia and Theileria parasites often share tick vectors and vertebrate hosts, increasing the likelihood of simultaneous transmission. The transmission routes of Babesia and Theileria species differ markedly. Theileria species are transmitted exclusively via the transstadial route, whereas Babesia species can transmit via both transstadial and transovarian routes, highlighting fundamental differences in their epidemiology and vector-host interactions (1,3,21,48). Mixed infections can complicate disease diagnosis and management in affected animals, as they may result in concurrent or more severe clinical signs compared to single infections. In this study, the co-occurrence of B. ovis and T. ovis was detected in 3 of 127 pools, consistent with previous reports (2,19,20).
The detection of pathogens in ticks that have fed on hosts does not necessarily confirm the vector competence of the tick species (49-51). In this study, ticks screened for piroplasm parasites were collected from infested goats. Therefore, it is important to emphasize that the identification of parasite DNA in these feeding ticks may reflect the presence of pathogens in the host’s bloodstream rather than active transmission or vector capacity. This constitutes a major limitation of the present study and should be considered when interpreting the results.
Conclusion
The current study provides molecular evidence of the presence of two significant piroplasms (B. ovis, T. ovis) in ticks reared on goats in Türkiye’s Mediterranean region. Babesia ovis was predominantly identified in Rhipicephalus species, whereas it was found only sporadically in H. marginatum. Theileria ovis was also identified in the same tick species, and notably in D. raskamensis.
Acknowledgments
We want to thank Sezayi Ozubek, Arda Eyvaz, Mehmet Alataş, Havva Nur Çevik, and Halil Ünal for their support.
Conflict of interest
There is no conflict of interest.